ID: 954792933

View in Genome Browser
Species Human (GRCh38)
Location 3:53146286-53146308
Sequence CCACTGGGTACCAGAGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954792933_954792940 5 Left 954792933 3:53146286-53146308 CCAAGGGCTCTGGTACCCAGTGG No data
Right 954792940 3:53146314-53146336 AATCCATGTGTTTGAATGGCTGG No data
954792933_954792942 10 Left 954792933 3:53146286-53146308 CCAAGGGCTCTGGTACCCAGTGG No data
Right 954792942 3:53146319-53146341 ATGTGTTTGAATGGCTGGAAAGG No data
954792933_954792944 16 Left 954792933 3:53146286-53146308 CCAAGGGCTCTGGTACCCAGTGG No data
Right 954792944 3:53146325-53146347 TTGAATGGCTGGAAAGGGCAAGG No data
954792933_954792943 11 Left 954792933 3:53146286-53146308 CCAAGGGCTCTGGTACCCAGTGG No data
Right 954792943 3:53146320-53146342 TGTGTTTGAATGGCTGGAAAGGG No data
954792933_954792938 1 Left 954792933 3:53146286-53146308 CCAAGGGCTCTGGTACCCAGTGG No data
Right 954792938 3:53146310-53146332 TGCCAATCCATGTGTTTGAATGG No data
954792933_954792945 17 Left 954792933 3:53146286-53146308 CCAAGGGCTCTGGTACCCAGTGG No data
Right 954792945 3:53146326-53146348 TGAATGGCTGGAAAGGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954792933 Original CRISPR CCACTGGGTACCAGAGCCCT TGG (reversed) Intergenic