ID: 954792938

View in Genome Browser
Species Human (GRCh38)
Location 3:53146310-53146332
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954792930_954792938 6 Left 954792930 3:53146281-53146303 CCCTCCCAAGGGCTCTGGTACCC No data
Right 954792938 3:53146310-53146332 TGCCAATCCATGTGTTTGAATGG No data
954792931_954792938 5 Left 954792931 3:53146282-53146304 CCTCCCAAGGGCTCTGGTACCCA No data
Right 954792938 3:53146310-53146332 TGCCAATCCATGTGTTTGAATGG No data
954792933_954792938 1 Left 954792933 3:53146286-53146308 CCAAGGGCTCTGGTACCCAGTGG No data
Right 954792938 3:53146310-53146332 TGCCAATCCATGTGTTTGAATGG No data
954792932_954792938 2 Left 954792932 3:53146285-53146307 CCCAAGGGCTCTGGTACCCAGTG No data
Right 954792938 3:53146310-53146332 TGCCAATCCATGTGTTTGAATGG No data
954792929_954792938 7 Left 954792929 3:53146280-53146302 CCCCTCCCAAGGGCTCTGGTACC No data
Right 954792938 3:53146310-53146332 TGCCAATCCATGTGTTTGAATGG No data
954792927_954792938 12 Left 954792927 3:53146275-53146297 CCTGACCCCTCCCAAGGGCTCTG No data
Right 954792938 3:53146310-53146332 TGCCAATCCATGTGTTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type