ID: 954792943

View in Genome Browser
Species Human (GRCh38)
Location 3:53146320-53146342
Sequence TGTGTTTGAATGGCTGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954792937_954792943 -5 Left 954792937 3:53146302-53146324 CCAGTGGGTGCCAATCCATGTGT No data
Right 954792943 3:53146320-53146342 TGTGTTTGAATGGCTGGAAAGGG No data
954792936_954792943 -4 Left 954792936 3:53146301-53146323 CCCAGTGGGTGCCAATCCATGTG No data
Right 954792943 3:53146320-53146342 TGTGTTTGAATGGCTGGAAAGGG No data
954792930_954792943 16 Left 954792930 3:53146281-53146303 CCCTCCCAAGGGCTCTGGTACCC No data
Right 954792943 3:53146320-53146342 TGTGTTTGAATGGCTGGAAAGGG No data
954792933_954792943 11 Left 954792933 3:53146286-53146308 CCAAGGGCTCTGGTACCCAGTGG No data
Right 954792943 3:53146320-53146342 TGTGTTTGAATGGCTGGAAAGGG No data
954792932_954792943 12 Left 954792932 3:53146285-53146307 CCCAAGGGCTCTGGTACCCAGTG No data
Right 954792943 3:53146320-53146342 TGTGTTTGAATGGCTGGAAAGGG No data
954792929_954792943 17 Left 954792929 3:53146280-53146302 CCCCTCCCAAGGGCTCTGGTACC No data
Right 954792943 3:53146320-53146342 TGTGTTTGAATGGCTGGAAAGGG No data
954792931_954792943 15 Left 954792931 3:53146282-53146304 CCTCCCAAGGGCTCTGGTACCCA No data
Right 954792943 3:53146320-53146342 TGTGTTTGAATGGCTGGAAAGGG No data
954792927_954792943 22 Left 954792927 3:53146275-53146297 CCTGACCCCTCCCAAGGGCTCTG No data
Right 954792943 3:53146320-53146342 TGTGTTTGAATGGCTGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954792943 Original CRISPR TGTGTTTGAATGGCTGGAAA GGG Intergenic
No off target data available for this crispr