ID: 954792945

View in Genome Browser
Species Human (GRCh38)
Location 3:53146326-53146348
Sequence TGAATGGCTGGAAAGGGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954792930_954792945 22 Left 954792930 3:53146281-53146303 CCCTCCCAAGGGCTCTGGTACCC No data
Right 954792945 3:53146326-53146348 TGAATGGCTGGAAAGGGCAAGGG No data
954792931_954792945 21 Left 954792931 3:53146282-53146304 CCTCCCAAGGGCTCTGGTACCCA No data
Right 954792945 3:53146326-53146348 TGAATGGCTGGAAAGGGCAAGGG No data
954792933_954792945 17 Left 954792933 3:53146286-53146308 CCAAGGGCTCTGGTACCCAGTGG No data
Right 954792945 3:53146326-53146348 TGAATGGCTGGAAAGGGCAAGGG No data
954792937_954792945 1 Left 954792937 3:53146302-53146324 CCAGTGGGTGCCAATCCATGTGT No data
Right 954792945 3:53146326-53146348 TGAATGGCTGGAAAGGGCAAGGG No data
954792927_954792945 28 Left 954792927 3:53146275-53146297 CCTGACCCCTCCCAAGGGCTCTG No data
Right 954792945 3:53146326-53146348 TGAATGGCTGGAAAGGGCAAGGG No data
954792936_954792945 2 Left 954792936 3:53146301-53146323 CCCAGTGGGTGCCAATCCATGTG No data
Right 954792945 3:53146326-53146348 TGAATGGCTGGAAAGGGCAAGGG No data
954792929_954792945 23 Left 954792929 3:53146280-53146302 CCCCTCCCAAGGGCTCTGGTACC No data
Right 954792945 3:53146326-53146348 TGAATGGCTGGAAAGGGCAAGGG No data
954792939_954792945 -9 Left 954792939 3:53146312-53146334 CCAATCCATGTGTTTGAATGGCT No data
Right 954792945 3:53146326-53146348 TGAATGGCTGGAAAGGGCAAGGG No data
954792932_954792945 18 Left 954792932 3:53146285-53146307 CCCAAGGGCTCTGGTACCCAGTG No data
Right 954792945 3:53146326-53146348 TGAATGGCTGGAAAGGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954792945 Original CRISPR TGAATGGCTGGAAAGGGCAA GGG Intergenic
No off target data available for this crispr