ID: 954793316 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:53148439-53148461 |
Sequence | GAGGCTGACCTCTGAGTGCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
954793305_954793316 | 25 | Left | 954793305 | 3:53148391-53148413 | CCAGACAGGATCAAAAATTGAGT | No data | ||
Right | 954793316 | 3:53148439-53148461 | GAGGCTGACCTCTGAGTGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
954793316 | Original CRISPR | GAGGCTGACCTCTGAGTGCA GGG | Intergenic | ||