ID: 954793316

View in Genome Browser
Species Human (GRCh38)
Location 3:53148439-53148461
Sequence GAGGCTGACCTCTGAGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954793305_954793316 25 Left 954793305 3:53148391-53148413 CCAGACAGGATCAAAAATTGAGT No data
Right 954793316 3:53148439-53148461 GAGGCTGACCTCTGAGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954793316 Original CRISPR GAGGCTGACCTCTGAGTGCA GGG Intergenic