ID: 954793723

View in Genome Browser
Species Human (GRCh38)
Location 3:53150741-53150763
Sequence CTTTCCAGGCAGAAACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954793723_954793732 24 Left 954793723 3:53150741-53150763 CCCTCCAGTTTCTGCCTGGAAAG No data
Right 954793732 3:53150788-53150810 ATGATCTTCACCACAAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954793723 Original CRISPR CTTTCCAGGCAGAAACTGGA GGG (reversed) Intergenic
No off target data available for this crispr