ID: 954795197

View in Genome Browser
Species Human (GRCh38)
Location 3:53157830-53157852
Sequence GGCCAGTGCTCTGGGTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 277}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954795192_954795197 -5 Left 954795192 3:53157812-53157834 CCCACTCTCTCTTGGCCAGGCCA 0: 1
1: 0
2: 2
3: 28
4: 234
Right 954795197 3:53157830-53157852 GGCCAGTGCTCTGGGTGTGATGG 0: 1
1: 0
2: 1
3: 31
4: 277
954795189_954795197 8 Left 954795189 3:53157799-53157821 CCAGAAACACAAGCCCACTCTCT 0: 1
1: 0
2: 1
3: 22
4: 246
Right 954795197 3:53157830-53157852 GGCCAGTGCTCTGGGTGTGATGG 0: 1
1: 0
2: 1
3: 31
4: 277
954795188_954795197 14 Left 954795188 3:53157793-53157815 CCTGCTCCAGAAACACAAGCCCA 0: 1
1: 4
2: 0
3: 42
4: 322
Right 954795197 3:53157830-53157852 GGCCAGTGCTCTGGGTGTGATGG 0: 1
1: 0
2: 1
3: 31
4: 277
954795193_954795197 -6 Left 954795193 3:53157813-53157835 CCACTCTCTCTTGGCCAGGCCAG 0: 1
1: 0
2: 6
3: 60
4: 622
Right 954795197 3:53157830-53157852 GGCCAGTGCTCTGGGTGTGATGG 0: 1
1: 0
2: 1
3: 31
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954795197 Original CRISPR GGCCAGTGCTCTGGGTGTGA TGG Intronic
900138280 1:1127989-1128011 GGCCCGTGCTGTGGGAGTGGGGG + Intergenic
900302451 1:1984866-1984888 GGTCAGTGCTGTGGATGTCATGG + Intronic
900733096 1:4275858-4275880 GACCAGGATTCTGGGTGTGAGGG + Intergenic
901731253 1:11281428-11281450 AGGCAGTGCTCTGGGTGCTAGGG - Intronic
901855053 1:12039188-12039210 GGCCAGTGCTGAGGCTGTGAGGG + Intergenic
902360718 1:15941357-15941379 GGCCACTGCCCTGGCTCTGATGG - Intergenic
902399816 1:16151724-16151746 GGGCAGTGGTCAGGATGTGAGGG - Intronic
902432959 1:16377821-16377843 TGCCATTGCTCTGAGTGTGAAGG + Intronic
902512431 1:16973707-16973729 GGCCTGGGCTCTGTGTGTGAAGG - Intergenic
902576613 1:17381905-17381927 GGCCAGCACTCTGGGGGTGGAGG - Intronic
902695736 1:18139613-18139635 GGACAGGTCTCTGGGTTTGAAGG + Intronic
903136101 1:21310284-21310306 GCCGAATTCTCTGGGTGTGAAGG - Intronic
903348349 1:22702331-22702353 GGCGAGTGAGCTGGGTGTGGAGG - Intergenic
903396631 1:23006586-23006608 GGGCATTGCTCTGGGTTTGGGGG - Intergenic
903442233 1:23396713-23396735 GGGCAGGGCGCTGGGTGTGATGG + Intronic
903573860 1:24325734-24325756 GGCCAGTGCTCTGGGAGGAGGGG - Intronic
903639429 1:24848389-24848411 TGCCAGCGGTCTGGGTGTGACGG + Intergenic
904859378 1:33523259-33523281 TGCCAGTGATCTGGGAGTCAGGG + Intronic
905204254 1:36334030-36334052 GGCCAGTGCTATGGGTAAAAGGG - Intergenic
905788868 1:40779567-40779589 GGAGAGTGCTCAGGGGGTGATGG - Intergenic
905893056 1:41529002-41529024 GGTCAGTGGTGTGAGTGTGAGGG - Intronic
907162333 1:52380103-52380125 GGGCAGTGTTCTGGGAATGAGGG - Intronic
907345883 1:53779893-53779915 GGCCAGAGCTATGGATTTGAAGG - Intronic
908296264 1:62716472-62716494 TGCCAGTGCTTGGGGTGAGAAGG - Intergenic
909203619 1:72725464-72725486 TGCCAAAGCTCTGAGTGTGATGG - Intergenic
910269574 1:85379293-85379315 GGCCGATGCTGTGGATGTGATGG - Intronic
910413884 1:86976781-86976803 TGGCAGTGGGCTGGGTGTGATGG + Intronic
910490645 1:87765646-87765668 GATCAGTGCTCTGGAAGTGAAGG - Intergenic
913427074 1:118745087-118745109 GGCAAGGGCTCTGGGGCTGAAGG - Intergenic
914433834 1:147642547-147642569 GGCCAGGTCTCAGGGGGTGATGG + Exonic
917795535 1:178530241-178530263 GGCCAGTGCTGTGGCAGTGATGG - Intronic
917796705 1:178538087-178538109 GCGGAGTGCTCTGGGTGTGAGGG + Intronic
917969952 1:180199965-180199987 AGCCTGTCCTCTGGGTGTGGGGG + Exonic
917980837 1:180267971-180267993 GGCCAGAGCTGTGGGGGTGGTGG - Intronic
918213279 1:182370789-182370811 GGGCAGCCCTTTGGGTGTGAGGG - Intergenic
920842391 1:209565695-209565717 GGCCAGTACTGGGGATGTGAGGG - Intergenic
920902687 1:210127261-210127283 AGCCACTGCCCTGGGAGTGAGGG - Intronic
923018956 1:230148210-230148232 GGCCACTGATCTGGTTGTGCCGG - Intronic
1062802441 10:390054-390076 TGGCAGTGTGCTGGGTGTGACGG - Exonic
1066291779 10:34020976-34020998 GGACATTATTCTGGGTGTGAGGG + Intergenic
1067347081 10:45444462-45444484 GGACAGAGCTCAGGGTGTGCAGG + Intronic
1069891159 10:71653227-71653249 GGTCAATGCTGTGGGTGGGAGGG - Intronic
1072056862 10:91766818-91766840 GGTCAGTGATCTGGCTGCGAAGG + Intergenic
1072615534 10:97046875-97046897 GGCCAGGACTCTGTGTGTGGGGG - Intronic
1073138154 10:101230842-101230864 GGCCAGGGCTGTGTGTGTGTGGG - Intergenic
1073447737 10:103591328-103591350 GGCCAGGGCCCTGGGTGGGGAGG + Exonic
1074766677 10:116705129-116705151 GGTGAGTGCTGTGGGTGGGAGGG - Exonic
1075930548 10:126291721-126291743 GCCCAGGGCTCGGGGGGTGATGG + Intronic
1075955386 10:126518948-126518970 AGGCAGTGCTCAGGGTGTGTGGG + Intronic
1076414753 10:130277715-130277737 TGACAGAGCTCTGGCTGTGAGGG + Intergenic
1076693345 10:132234909-132234931 GGCAAGTGATGTGGCTGTGAAGG + Intronic
1076750620 10:132540755-132540777 AGGCAGTGCTCAGGCTGTGAAGG + Intronic
1077482044 11:2819675-2819697 GGCTAGTGCTCTGGGATGGATGG + Intronic
1078107535 11:8368114-8368136 GTCCACTTCTTTGGGTGTGATGG - Intergenic
1078355412 11:10628609-10628631 GGGTCTTGCTCTGGGTGTGAAGG + Intronic
1081604175 11:44517061-44517083 GGCCAGTGGAGTGGGAGTGATGG + Intergenic
1082078258 11:47991662-47991684 GGAGATTGTTCTGGGTGTGAAGG + Intronic
1083205419 11:61145870-61145892 GGCCAGGGCTCTGGTACTGAGGG - Intronic
1083749544 11:64753744-64753766 GGGCAGAGCTCTGGGGGTGTGGG - Intronic
1084782361 11:71418661-71418683 GCCCAGTGCTCAGGGAGTCAAGG + Intergenic
1086316734 11:85602695-85602717 GGCCTTTGCTCTGAGTGGGATGG - Intronic
1086426550 11:86689399-86689421 GGCCAGGTCTCTGGGTCTGCTGG - Intergenic
1090855794 11:130608470-130608492 GGCCTGTGCTAGGCGTGTGAAGG - Intergenic
1091796049 12:3297985-3298007 TGCCAAGGCTCTGGCTGTGAGGG + Intergenic
1091890671 12:4051730-4051752 GGCCAATGCTGTGGTTGTGGTGG + Intergenic
1092109923 12:5952656-5952678 GGTCTGTGTTCTGGGTGTGGGGG - Intronic
1095985038 12:47993808-47993830 GGCGGGTGCTCCTGGTGTGAAGG - Exonic
1096225753 12:49865920-49865942 GGCCAGGGCGCTGTGTGGGAGGG - Intergenic
1097546668 12:61011172-61011194 AGCCAGTGCTTTGGCTGTCATGG - Intergenic
1098345101 12:69494278-69494300 GGCCAGAGCTCTGTCTGTGATGG + Intronic
1098833490 12:75391425-75391447 GGCCACTGCTCTGAGGCTGAAGG + Intronic
1101789090 12:107911797-107911819 GGCCAGTACTGTGGATGCGAGGG + Intergenic
1102733324 12:115134553-115134575 GACCAGTGCTGTGGGTGGGAAGG + Intergenic
1103176925 12:118872221-118872243 GGTAAGTGCCCTTGGTGTGATGG - Intergenic
1103837912 12:123838689-123838711 GGTCAGCCCTCTGGGTGTGCAGG + Exonic
1105726623 13:23169150-23169172 CTCCTGTGCTCTGGGTGGGAAGG - Intergenic
1111572198 13:90103631-90103653 GGCCACTGCTGGGGGGGTGAAGG + Intergenic
1112349983 13:98624889-98624911 GTCCAGTGATCTGGGAGTGCTGG - Intergenic
1113808152 13:113121895-113121917 GGCCAGTGCTGTGGGTGTTAGGG + Intergenic
1115755895 14:36525545-36525567 GGCCATTGGGGTGGGTGTGAGGG + Intergenic
1115921810 14:38382650-38382672 GGACATTGCAATGGGTGTGAGGG + Intergenic
1117202961 14:53411334-53411356 AGGCAGTGTTCTGGGTGTGTGGG - Intergenic
1121015433 14:90546166-90546188 GGCCAGTCCTCTAGCTGTGCTGG - Intronic
1122330865 14:100911547-100911569 GCTCAGTGATCTGGGTTTGAGGG + Intergenic
1122748036 14:103911251-103911273 TGCCAGTGCAGTGGATGTGAAGG + Intergenic
1123060446 14:105592001-105592023 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1123084924 14:105712972-105712994 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1124150655 15:27175134-27175156 AGCCAGTGCCCTGGGTGGGAGGG - Intronic
1125629257 15:41133907-41133929 GGCCAGTGCTCTGGGGGCTCTGG - Intergenic
1125693445 15:41615636-41615658 GGCCTGTGGGCTGGGTGTGGTGG + Intergenic
1125744048 15:41987171-41987193 GGCCAGTTCTCTAGGTGGAAAGG - Exonic
1129612834 15:77074063-77074085 ATCCAGTGCTCTGGGTGAGCTGG - Intronic
1129892715 15:79082138-79082160 GGCCAGTGGACTGGGGGTGGGGG + Intronic
1130283830 15:82539830-82539852 GGCTAGAGCTCTGCGTGTGCAGG - Intronic
1131091760 15:89629175-89629197 GGCCAGGGCTGTGGGGGTGGGGG + Intronic
1132223621 15:100123893-100123915 GACCAGTCATCGGGGTGTGATGG + Intronic
1132456256 16:24775-24797 GGCCAGTGCTTTGTGTTTTAAGG + Intergenic
1132470747 16:101637-101659 GGCCAGTGCTCTGGGTGGCTTGG - Intronic
1133442903 16:5835859-5835881 GGACTGTGCTCTGGGAGGGATGG - Intergenic
1135057388 16:19241907-19241929 TGCCATTGCTCTGGCTGTGGTGG - Intronic
1136390850 16:29963263-29963285 GGCCAGTCCTGTGGGTGAGGAGG - Exonic
1136616660 16:31402328-31402350 GGCCAGTGAGCCGTGTGTGATGG + Intronic
1139367614 16:66443204-66443226 AGCCAGTGCTCTGTCTCTGAGGG + Intronic
1140932902 16:79644190-79644212 GTCCAGTGCTCTGGGGTTGCTGG - Intergenic
1141751357 16:85960605-85960627 AGCCGTTGCTCTGGTTGTGAAGG - Intergenic
1142053267 16:87974604-87974626 GACCAGTGGTATGGGTGGGAAGG + Intronic
1142269139 16:89080055-89080077 GGCCACTGCTCTGATTGTGCAGG + Intergenic
1142360629 16:89624830-89624852 GGCCAGTTTTCTGGGTCTTAAGG + Intronic
1142476695 17:193224-193246 GGCTGGAGCTCTTGGTGTGAAGG + Intergenic
1142850770 17:2703750-2703772 GGGCATTGCTCTGGGTCTGCAGG - Intronic
1142993601 17:3747995-3748017 GGGCAGTGCGCTGGGGGTGAAGG + Exonic
1143441622 17:6978994-6979016 GGCGTGTGTGCTGGGTGTGACGG - Intronic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1144589489 17:16512197-16512219 CCCCACTGCTCTGGGTGTGTTGG + Intergenic
1146950023 17:36899591-36899613 GGCTAGAGCTCTGGGGGTGCGGG - Intergenic
1148206859 17:45784640-45784662 GGGCTGGGCTGTGGGTGTGATGG + Intronic
1149008519 17:51830896-51830918 GGCCTGTGGTCTAGCTGTGAAGG - Intronic
1151481437 17:74372119-74372141 GTCCAGTGTTCTGGGTGAGTCGG - Exonic
1151785631 17:76273650-76273672 GTCCAGCACTCTGGGGGTGAGGG - Intergenic
1152160662 17:78666668-78666690 GGCCGCTGGTCTGGGAGTGAGGG + Intergenic
1152251861 17:79216581-79216603 GGCCTGTGCTCTGGGCCTGAGGG - Intronic
1152506818 17:80754990-80755012 GCCCAGGGCTGTGGGTGAGAAGG - Intronic
1152535715 17:80949372-80949394 GGCCTGTGCTCTGTGCGTGGTGG - Intronic
1153560864 18:6370574-6370596 TGCCACTGCCCTGGGTGGGAGGG - Intronic
1154935920 18:21056679-21056701 GGCTTTTGCTCTGGGTGAGATGG - Intronic
1155064077 18:22253928-22253950 GGCCTGGGCTCTGGGGGTGCAGG + Intergenic
1155260624 18:24038826-24038848 GGCCTTTTCTCTGAGTGTGAGGG + Intronic
1158127692 18:54120173-54120195 GTCCAGTGCCCTTGATGTGATGG - Intergenic
1158591350 18:58781452-58781474 GCCCAGTTGTCTGGGTTTGAAGG + Intergenic
1160826502 19:1082737-1082759 GGCCAGTGCTCTGTGGGGGTGGG + Intronic
1160927585 19:1554370-1554392 GCCCAGCTCTCTGGGTGTGTGGG - Intergenic
1161218107 19:3104817-3104839 GGCCTGTGCTGTGGGGGTGCTGG + Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1164720078 19:30425528-30425550 GGCCAGTGCTGAGGAGGTGAAGG - Intronic
1165502722 19:36202933-36202955 GGGCAGTACTCTGGATGTGCGGG - Intronic
1166679794 19:44759341-44759363 GGCCTGAGATCTGGGTCTGAGGG - Intronic
1166996626 19:46722626-46722648 CGCCAGTGCCCTGGCTGTGAGGG + Intronic
1167348811 19:48962760-48962782 GGCCAGAGGTCTGGGTGCCAGGG - Intergenic
1168327699 19:55546578-55546600 GGCCAGCACTCCTGGTGTGAAGG - Intergenic
1168386952 19:55971770-55971792 GGCCAGAGCAATGGGTATGAAGG + Intronic
1168576108 19:57511994-57512016 GGCCTGTGGTCTGAGGGTGAAGG + Intronic
926163399 2:10503455-10503477 GGCCAGGGCTCTGGGGGTCTGGG + Intergenic
927355112 2:22163963-22163985 GGTCCGTGCTCTGGGGGTTAGGG + Intergenic
927965805 2:27267349-27267371 GGCTGGTACTCTGAGTGTGATGG - Intronic
928087708 2:28356204-28356226 GGGCCCTGCTCTGGGTGGGAGGG - Intergenic
928339909 2:30433908-30433930 GGCTAGTGTTCTGGCAGTGATGG - Intergenic
928420722 2:31136458-31136480 GTTCAGTGCACTGGGTGTCATGG - Intronic
929751292 2:44716346-44716368 AGCCAGTGATCTTGGTGTGCTGG + Intronic
932291306 2:70582317-70582339 GGCGAGGGTGCTGGGTGTGAAGG + Intergenic
932411374 2:71549877-71549899 GGCCAGTGCCCTGTCTGTGCTGG + Intronic
933384190 2:81589439-81589461 GGCCAGTGCTCTGAGTGCATGGG - Intergenic
934736179 2:96691071-96691093 GGCCAGAGACCTGGATGTGAGGG + Intergenic
934934777 2:98457161-98457183 GGCCAGTGCCCTGAGTGTCTGGG - Intronic
937225088 2:120364089-120364111 GCCCAGTGTTCTGGGGGTGGGGG + Intergenic
937314186 2:120920529-120920551 GGGCAGTGTACTGGGTGTAATGG - Intronic
938029456 2:127980263-127980285 GGCCAGTGTTGGGGGTGGGAGGG - Intronic
941716624 2:168770419-168770441 GGTCAGTGCTCTGATTTTGAAGG + Exonic
944098450 2:195995627-195995649 GACCAGTGGTGTGGGGGTGAAGG + Intronic
948031828 2:234824327-234824349 GGCCAGTGCTCCTGCTGTGTGGG - Intergenic
948139398 2:235661517-235661539 GGCCAGGGCTGTGGGGGTGGGGG + Intronic
1168998914 20:2152548-2152570 GGTCACAGCTCTGGGTGTGTGGG + Intronic
1169060315 20:2656137-2656159 GGCCTCTGCTATGGGGGTGATGG + Intronic
1169209774 20:3759517-3759539 GGGCAGGGCTCTTGGTGGGAGGG - Intronic
1169430676 20:5533275-5533297 GGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1169831567 20:9831046-9831068 GCCCAGTGGGCTGGGTGTGGGGG + Intronic
1170546394 20:17438746-17438768 GGGCTGTGCCCTGGGTGTGGGGG - Intronic
1171400559 20:24870860-24870882 GGCCAGGGCTCCAGGAGTGAGGG - Intergenic
1171459301 20:25289875-25289897 GTCCAATGCTTTAGGTGTGACGG - Intronic
1172755337 20:37279937-37279959 GGCCAGTTAACTGGGTGTGATGG - Intergenic
1172947973 20:38703253-38703275 GGCCATTGCTCTGAATGAGATGG + Intergenic
1173405427 20:42760197-42760219 GCCCAGTGCTCTAGGGTTGAGGG + Intronic
1174399922 20:50270417-50270439 GCCCATTGCTCTGGGCATGATGG - Intergenic
1174847781 20:53959961-53959983 GTCCAAAGCTTTGGGTGTGATGG - Intronic
1175532396 20:59682897-59682919 GGCTTTTGCTCTGAGTGTGACGG + Intronic
1175841810 20:62032803-62032825 GGCCAGTGCCCAGTGTGTGCTGG - Intronic
1176948318 21:15011474-15011496 GGCCAGTACTCTGGGCGTGGTGG - Intronic
1177720655 21:24902705-24902727 GGACACTGCTCTGGTTATGATGG - Intergenic
1178611696 21:34087793-34087815 GGACAGTGATCTGGATGAGATGG + Intronic
1179963045 21:44781671-44781693 GGGCCCTGCTCTGGGGGTGAGGG - Intronic
1181367856 22:22392390-22392412 GACCAGTGCTGTGGGTCTGGTGG + Intergenic
1181419889 22:22790413-22790435 GCCAGGTGCTCTGGGTCTGAGGG + Intronic
1181464235 22:23102209-23102231 GGCCAGTGCTCAGTGAATGATGG + Intronic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1182943376 22:34299675-34299697 AGCAAGTGCTCAGGGTGTCATGG - Intergenic
1183323915 22:37181109-37181131 GGCCTGTGTTCTGGGTGTTCAGG - Exonic
1183377728 22:37474716-37474738 GCCCACGGCTCTGGGTGTGGAGG - Intronic
1183439214 22:37813745-37813767 GAATAATGCTCTGGGTGTGAGGG - Intronic
1183457530 22:37930737-37930759 AGCCTGGGCTCTGGGTGTGTGGG + Intronic
1183579174 22:38713203-38713225 GGGGAGTGCTGTGTGTGTGATGG + Intronic
1184761620 22:46547960-46547982 GTCCATTTCTCTGGGTGTGCAGG - Intergenic
1184802857 22:46773159-46773181 GGCCTGTGTTCAGGGGGTGAAGG - Intronic
1185308894 22:50141699-50141721 GCCCAGGGCTCTGGGTCTCACGG - Intronic
1185344132 22:50304072-50304094 GGGCTGGCCTCTGGGTGTGAAGG + Intronic
950118823 3:10468311-10468333 GCCCAGCGGGCTGGGTGTGAGGG + Intronic
950552826 3:13677009-13677031 GGCCTGGGCTCTGGGAGTTAGGG + Intergenic
952541676 3:34373559-34373581 GGCCAGAGCTGTGGATGGGATGG + Intergenic
953930701 3:47004393-47004415 GGTGAGAGCCCTGGGTGTGAGGG + Exonic
954426085 3:50443816-50443838 GGACAGTGGGCTGGGAGTGAAGG + Intronic
954716119 3:52527772-52527794 GGCCAGGGCTCTGGGTGGGGAGG - Intronic
954795197 3:53157830-53157852 GGCCAGTGCTCTGGGTGTGATGG + Intronic
955698949 3:61664340-61664362 GCCCAGAGCTCTTGGTCTGATGG + Intronic
956102102 3:65779237-65779259 TGCCAGAGCCCTGGGTGTGATGG - Intronic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
959213786 3:103423769-103423791 GGACAGTGCTCTGGGTGGCCTGG + Intergenic
961450340 3:126999673-126999695 GGCCAGGGCTGTGGCGGTGATGG + Intronic
961467203 3:127089193-127089215 GGCCACTGCTCTGAGTGTCCTGG + Intergenic
961811242 3:129523116-129523138 GGCCAGTGTTCTGGATCTGCAGG - Intergenic
963010092 3:140760552-140760574 GGCCAGGGATCTGGGTGGTAAGG + Intergenic
964613877 3:158642030-158642052 GGCAAGTGCTCAGTGTGGGAAGG + Intergenic
967726230 3:192864843-192864865 TAACAGTGCTCTGGGTGAGAGGG - Intronic
967971331 3:195001797-195001819 GCCAAGTGCTCTGGGAGGGAGGG - Intergenic
968576086 4:1366804-1366826 GGCCGGTGTGCTGGGTGTGCAGG - Intronic
968937527 4:3619928-3619950 GGCCTGTCCTCTGAGTGTGAGGG + Intergenic
971253056 4:24989262-24989284 GGCCAAGGCTCTGGATGTGGGGG + Intergenic
971361633 4:25943380-25943402 GGCCAATGGGCTGGGAGTGAAGG + Intergenic
972351865 4:38243540-38243562 AGCCAGGGCTGTGGCTGTGAAGG + Intergenic
972918759 4:43911127-43911149 GGCCAGTGATCTAGGTGTGGGGG - Intergenic
976613154 4:87050311-87050333 TCCTAGTGCTCTGAGTGTGAGGG + Intronic
976987345 4:91318102-91318124 GGCCCATGCTCTGGGTGGGGAGG + Intronic
977260236 4:94788516-94788538 AGCCAGTGCTCTGGGTGGTCTGG - Intronic
979307934 4:119169548-119169570 GGCCAGGGCTCTGGAGATGAGGG + Intronic
984349936 4:178577465-178577487 GGTAAATGCTCTGGTTGTGATGG - Intergenic
984590265 4:181609136-181609158 GGCCAGGAATGTGGGTGTGAAGG + Intergenic
985553470 5:544678-544700 GGCCAATGCTCTTGGGGTGTGGG + Intergenic
985607024 5:863304-863326 GGCCGGTGCTCTGTGTGGCATGG - Intronic
985610370 5:884665-884687 GGCAAGTGCCCAGGGTGGGAAGG - Intronic
985790552 5:1924857-1924879 TGCGAATGCTCTGGGTTTGATGG + Intergenic
986797273 5:11224217-11224239 GGCCAGTGCTTTGAGTGGAAAGG - Intronic
987736026 5:21844588-21844610 GGGCAGGGCTGTGAGTGTGATGG + Intronic
990449372 5:55920326-55920348 GGCCACTGCCCTGGGTGGCAGGG - Intronic
990807659 5:59684174-59684196 GGGCAGTGCTCAGGGAGGGATGG - Intronic
991939191 5:71833691-71833713 GGTCAGAGTTCTGGCTGTGATGG + Intergenic
993297420 5:86159828-86159850 GGCAACTGCTCTGGGTGTCTGGG + Intergenic
995851715 5:116553349-116553371 CGCCAGAGCTGTGGTTGTGATGG - Intronic
996292228 5:121865960-121865982 TGCCAGTGGTCTGGGTGTCTGGG - Intergenic
996503072 5:124238199-124238221 GAGCAGTGGTCTGGGTGTGGTGG + Intergenic
997468552 5:134104031-134104053 GGCCAGGGCTCAGGGTGGGCCGG - Intergenic
997878001 5:137566153-137566175 GGCCAGAGCCCTGGGAGTGAGGG - Intronic
999088628 5:148915211-148915233 GGCCAGTGACCTAGGTGGGAAGG - Intergenic
999195710 5:149780187-149780209 AGCCTGTGCTCTGGGTGTGTGGG - Intronic
1000009766 5:157220196-157220218 GGCCAGTCCTCTGGGGGTTGGGG + Intronic
1001101790 5:168820316-168820338 GGCCTGAGCTCAGGCTGTGATGG + Intronic
1001893894 5:175362460-175362482 GCCCAGAGCCCTGGGTGGGAGGG - Intergenic
1002146480 5:177186812-177186834 GACCTGTGTTCTGGGTGTGGTGG + Intronic
1002437100 5:179238408-179238430 TGCCAGTGCTCTGAGTATGCCGG + Intronic
1002541245 5:179907770-179907792 GGCCAATGCGCTGTGGGTGACGG - Exonic
1002661123 5:180791759-180791781 CGCCAAGGCTCTGGGTGTCATGG - Exonic
1003037765 6:2659968-2659990 GGCCAGTCCTCTGGAAGGGATGG + Intergenic
1006052027 6:31352669-31352691 GGCCTTTGCTCTGAGTGGGATGG - Intronic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1007813797 6:44505846-44505868 GGCAGGTGTTCTGGGTTTGACGG + Intergenic
1010203052 6:73299569-73299591 GGCCAGTGTGCAGGGCGTGAGGG - Intronic
1010452821 6:76021546-76021568 GGCCACCACTCTGAGTGTGAAGG - Intronic
1012177729 6:96109893-96109915 CCATAGTGCTCTGGGTGTGAGGG - Intronic
1016741413 6:147533109-147533131 GGTCTGGGCTCTGGGTGTGCTGG - Intronic
1017288379 6:152705005-152705027 TGCCAGTGATTTGGGGGTGAGGG - Intronic
1018171456 6:161146502-161146524 GGTCAGTGCACTGGGTGCCAGGG - Exonic
1018176905 6:161184962-161184984 CTCCTGTGCTCTGGGTGTGTGGG - Intronic
1018368839 6:163149326-163149348 GGCCAGTGCGCTGGGGAGGATGG - Intronic
1019027430 6:168980296-168980318 GGGCAGATCTCTGGGTGGGAAGG - Intergenic
1019577336 7:1743830-1743852 GGCCAGGGATGTGCGTGTGAAGG - Intronic
1019628050 7:2031302-2031324 GGCCAGTGGGGAGGGTGTGACGG - Intronic
1021730770 7:23593268-23593290 GCCCAGTGACCTGGGTGTGGTGG - Intergenic
1021864513 7:24941577-24941599 AGCCAGTGCTCTGGGTGAAGAGG - Intronic
1022490695 7:30815436-30815458 GGCCAGTGCTAGAGATGTGATGG - Intronic
1024537905 7:50453465-50453487 TGCCAGTTCTCTTGGTGTGAGGG + Intronic
1028638986 7:93022218-93022240 AGCCAGTCATCAGGGTGTGAGGG + Intergenic
1028753237 7:94406282-94406304 GCCCGGTGCTCCTGGTGTGAAGG + Exonic
1028922082 7:96320668-96320690 GGAAAGTACTCTGGGTGTGTGGG - Intronic
1029609003 7:101616678-101616700 GACCAGTGGTCTGGGTGAGGGGG + Intronic
1030942032 7:115663335-115663357 GGCCTGTGCACTGGCAGTGAGGG + Intergenic
1031971199 7:128066261-128066283 GGCCTGTGCTGTGGGTGAGCTGG - Intronic
1033656903 7:143381056-143381078 GGCCTGTGCTCAGGGAGTGGGGG + Intergenic
1034503323 7:151466215-151466237 GGCCCGTCATCTGGGTCTGAAGG + Exonic
1034822172 7:154226152-154226174 GGCCAGAGTTCTGGGGCTGAAGG + Intronic
1034965322 7:155387230-155387252 GGGCTGTGCTGTGGGGGTGAGGG + Intronic
1034998370 7:155592736-155592758 GGCCAGTGTCATGGGTGGGATGG - Intergenic
1036607850 8:10323465-10323487 GGCCAGTGCCTTCCGTGTGATGG + Intronic
1037683643 8:21119304-21119326 GCCCACTGCTCTGTGAGTGATGG - Intergenic
1039043565 8:33430185-33430207 GGCCAGTGCTCTGTCTTTCAAGG - Intronic
1041656735 8:60359760-60359782 AGACAGTGATCTGGCTGTGATGG - Intergenic
1042505503 8:69555368-69555390 GGCCAGTGGGCTGGGCGTGGTGG + Intronic
1044624519 8:94223769-94223791 AGCCAGTGGCCTGGGAGTGAGGG + Intergenic
1045470782 8:102510362-102510384 GCTCAGTGCTCTGGGGGTGCTGG + Intergenic
1045584217 8:103513150-103513172 GGCAAGTGCTCTGGGTGAGCTGG + Intronic
1047489718 8:125364516-125364538 GGCCAGAGCTCTGTGTGGGCAGG + Intronic
1048428520 8:134344820-134344842 GACCTGTGCTCTGGGTAAGAGGG + Intergenic
1048504274 8:135006623-135006645 GCCCAGCGATCTGGGTGAGAGGG + Intergenic
1049554219 8:143274168-143274190 GGCCAGTGCGCTGGGCCTGCTGG + Intronic
1050593901 9:7186882-7186904 GGCCAGTGAACTGAGGGTGAGGG - Intergenic
1052867181 9:33471343-33471365 GGCTGTTGCTCTGGGTGAGATGG - Intronic
1054453629 9:65417765-65417787 GGCCTGTCCTCTGAGTGTGAGGG - Intergenic
1055310646 9:74976149-74976171 GGACAGGGCTCTGGGTGCCAGGG + Intergenic
1055641377 9:78321142-78321164 GTGAAGAGCTCTGGGTGTGAAGG - Intronic
1055972346 9:81924131-81924153 GGACAGTGGTCAGGATGTGAGGG + Intergenic
1055974099 9:81939203-81939225 GGACAGTGGTCAGGATGTGAGGG + Intergenic
1056206080 9:84320637-84320659 GGACACTGCTTTGGGTGTGGGGG + Intronic
1059011540 9:110466961-110466983 GGCCAGTACTCTGGGAGTCAGGG - Intronic
1059357192 9:113708981-113709003 AGGCAGGGCTCTGGGTGTGGAGG + Intergenic
1059876150 9:118637286-118637308 TGCCAGTGCTCTGGGCCTCATGG + Intergenic
1061411254 9:130422988-130423010 GGTCAGTGTTCTGGGGGTGCGGG + Intronic
1062309434 9:135928199-135928221 AGCCAGTGCTGTGGGCGGGAAGG + Intergenic
1186411000 X:9344244-9344266 GGGCAGTGCTTTGGGAGAGAGGG - Intergenic
1187070997 X:15888244-15888266 AGCCTGTGCTCTGGGTGTCCAGG - Intergenic
1190414805 X:50170445-50170467 GACCAGTGTTATGGGTTTGAGGG - Intergenic
1193278541 X:79620847-79620869 GGCAGGTGGTCTGGGGGTGAGGG - Intergenic
1198107557 X:133475965-133475987 TGCCAGTGCCCTGGGTGGGTGGG + Intergenic
1198393098 X:136196177-136196199 GGCCAGTGAGGTGGGAGTGAGGG + Intronic
1200074379 X:153543926-153543948 GGCCAGTGCGCGGGGTGTGGGGG + Intronic
1200400107 X:156014949-156014971 GGCCAGTGCTTTGTGTTTTAAGG - Intergenic