ID: 954795647

View in Genome Browser
Species Human (GRCh38)
Location 3:53160322-53160344
Sequence GTCCTGGGGAACCACCTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954795647_954795658 21 Left 954795647 3:53160322-53160344 CCTTCTAGGTGGTTCCCCAGGAC 0: 1
1: 0
2: 1
3: 11
4: 112
Right 954795658 3:53160366-53160388 CCTGGGAAGTGACATTTCTTTGG 0: 1
1: 0
2: 2
3: 21
4: 228
954795647_954795654 4 Left 954795647 3:53160322-53160344 CCTTCTAGGTGGTTCCCCAGGAC 0: 1
1: 0
2: 1
3: 11
4: 112
Right 954795654 3:53160349-53160371 AACCCTCTTTTTTGTCTCCTGGG 0: 1
1: 0
2: 1
3: 26
4: 303
954795647_954795653 3 Left 954795647 3:53160322-53160344 CCTTCTAGGTGGTTCCCCAGGAC 0: 1
1: 0
2: 1
3: 11
4: 112
Right 954795653 3:53160348-53160370 GAACCCTCTTTTTTGTCTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954795647 Original CRISPR GTCCTGGGGAACCACCTAGA AGG (reversed) Intronic
900098491 1:950866-950888 GTCTTGGGCAAGCACCTACAGGG + Intronic
901427318 1:9190699-9190721 GCCCTGGGAAACCAGCTAGGAGG - Intergenic
903015388 1:20358294-20358316 TTCCTGGTGAACCAGCTGGAAGG - Intergenic
903889070 1:26557701-26557723 GTTCTGGGAAACCTCCTATAAGG + Intronic
905347818 1:37323399-37323421 GACTTGGGGCCCCACCTAGAGGG - Intergenic
906711678 1:47934845-47934867 GTCCTGGAGAACCTTCAAGATGG + Intronic
908854920 1:68416029-68416051 GTCCTGGAGGACCACTCAGATGG - Intergenic
913118843 1:115721211-115721233 GTCCTGGGGAACTGCCCACAGGG - Intronic
917445080 1:175099941-175099963 GTCCAAGAGGACCACCTAGAGGG - Intronic
919821148 1:201472763-201472785 GTCCTGGGTAGCCACCCAGAGGG - Intergenic
920989310 1:210921605-210921627 GACCTCAGGAACCACCCAGATGG - Intronic
923739424 1:236641908-236641930 GACCTTGGAAACCACCTAAAAGG - Intergenic
1065046192 10:21749265-21749287 GCCCTGGGGAACCAGCAAGGTGG - Intergenic
1067166274 10:43868785-43868807 GTAATGGGGAACCACCCACAAGG - Intergenic
1069177586 10:65312785-65312807 GTCCTGTGGCCCCACCCAGAAGG + Intergenic
1072577073 10:96710025-96710047 GCTGTGGGGAGCCACCTAGAAGG - Intronic
1074616637 10:115075783-115075805 GTCCTGGGGCAACTCCTACATGG + Intergenic
1075250127 10:120861421-120861443 GTGCTGGGGAAACACCTAGGAGG + Intronic
1077436173 11:2540218-2540240 TGCCAGGGGAACCCCCTAGAGGG + Intronic
1080103513 11:28486619-28486641 CTTCTGGGCAACCACATAGATGG - Intergenic
1081290790 11:41322965-41322987 GTCCTGGCTAACCACAAAGAGGG + Intronic
1083891593 11:65598354-65598376 GTCCTGGGGGCCCCCCTGGAAGG + Exonic
1094680352 12:32661819-32661841 CTCCTGGGACACCACGTAGAAGG + Intergenic
1096870998 12:54592046-54592068 TTCCTGGGGGACCACTTGGATGG - Intergenic
1098150663 12:67543252-67543274 GTGCTGTGGAAACACCGAGAAGG + Intergenic
1098741980 12:74184586-74184608 CTTCTGGGGAACCCCATAGAGGG + Intergenic
1099450999 12:82806078-82806100 GTGCTGTGGAAGCATCTAGAGGG + Intronic
1104093269 12:125533614-125533636 GTCCTGGCGCACCCGCTAGATGG + Intronic
1108044127 13:46366886-46366908 GTCCTGGGGGGCCAGCCAGACGG + Intronic
1108790713 13:53966478-53966500 CTACTGGGGCACCACCTAGTGGG + Intergenic
1109073843 13:57806847-57806869 CACCTCAGGAACCACCTAGAGGG + Intergenic
1110988534 13:82007091-82007113 GCCCTAGGGAAGCACCTATAGGG + Intergenic
1112544856 13:100357430-100357452 TTCCTGGGCTACCACCTGGAAGG + Intronic
1115446866 14:33500429-33500451 GTGCAGCGGAACCATCTAGAAGG + Intronic
1117492179 14:56260154-56260176 CTCCTGGGTAAATACCTAGAGGG - Intronic
1119778173 14:77260870-77260892 GTCCTGAGGAACCTCCTTGCTGG + Intergenic
1121871973 14:97416442-97416464 GTCCTTGTAAACCACCCAGAGGG - Intergenic
1122004246 14:98688827-98688849 GGCCTTGGGAACCACCATGATGG + Intergenic
1126901847 15:53322497-53322519 GTTCTGGGAAATTACCTAGATGG + Intergenic
1128620253 15:69142900-69142922 GTATTGGGGAACAACCTAGCAGG + Intergenic
1130149716 15:81302115-81302137 GGCCTGGGGCAGCACCTAGAGGG - Intronic
1130566826 15:85003372-85003394 ATCCTGGGGAAAAACCAAGATGG + Intronic
1131923940 15:97361451-97361473 GTACTGGGAAAACACCTAGGTGG + Intergenic
1132909244 16:2299833-2299855 GCCCTGGGGAACCGGTTAGAGGG + Intronic
1138419908 16:56892504-56892526 ATCATGGGGACCCACCTAGCAGG + Intronic
1140977720 16:80076229-80076251 GTGCTGGGGAAGCACCTGGAGGG - Intergenic
1141706626 16:85668736-85668758 GTCCTGGGAGACAACCTAGTTGG + Intronic
1146373880 17:32281493-32281515 GTCCTGGGGAGCCCCCCAGTGGG - Intronic
1147313808 17:39609510-39609532 TCCCTGGGGAGCCTCCTAGAGGG - Intronic
1151305055 17:73257894-73257916 CTCCTGGGGAATCCCCTGGAGGG - Intronic
1151464656 17:74276695-74276717 GGCCTTGGGAAACACCAAGAAGG + Intronic
1152357964 17:79815693-79815715 GTCCATGAGAACCACCTGGAGGG + Intergenic
1157268827 18:46253289-46253311 GACCTGCGTAACCACCTAGAAGG - Intronic
1161536157 19:4819897-4819919 GTCCTTGAGGACCATCTAGAAGG - Intronic
1161674293 19:5635434-5635456 GTCCTGAGGCACCACCAAGCTGG + Intronic
1163166375 19:15500843-15500865 GACCTGGGGGACCACTGAGAGGG - Intergenic
1166053845 19:40277074-40277096 GTCCTGGGGACCCAATGAGATGG + Intronic
1166358213 19:42239967-42239989 GTCCTGGAGAACCTTCTTGATGG + Exonic
929980415 2:46673767-46673789 GTCCTTTGGTACCATCTAGATGG + Intergenic
934234993 2:90222855-90222877 GGGCTGGAGAAACACCTAGAAGG - Intergenic
934310437 2:91857842-91857864 GACCCGGGGAACCACCACGAAGG - Intergenic
936032220 2:109081594-109081616 GTCCTGGGGAACCAACCCCATGG + Intergenic
936141625 2:109946862-109946884 GTCTTGATGAACCACCCAGAGGG + Intergenic
936178313 2:110244810-110244832 GTCTTGATGAACCACCCAGAGGG + Intergenic
936203066 2:110424622-110424644 GTCTTGATGAACCACCCAGAGGG - Intronic
936400301 2:112159828-112159850 GACGTGGGGACCCACCTGGAAGG - Exonic
940498913 2:154469912-154469934 GACCTGGGTAAGCACCTTGATGG - Intergenic
945206892 2:207341998-207342020 GGCCTGGAGAACCACCTAGAGGG + Intergenic
946035165 2:216736233-216736255 ATCATGAGGAACCACCAAGAAGG + Intergenic
948062251 2:235050579-235050601 ATGCTGGGGGCCCACCTAGAAGG + Intronic
948584619 2:239011623-239011645 TTGCTGGGGAACCACCCACATGG - Intergenic
1168921074 20:1536902-1536924 GTCATGGGGAAACGCCTGGATGG + Intronic
1169350591 20:4865068-4865090 GTCCTGGGGAAGCACCGGGAAGG - Intronic
1170859696 20:20091106-20091128 GGCCTGGTGCACCACCTGGAAGG - Intronic
1181259273 22:21585738-21585760 ATCCTGGGGAAAGACATAGAGGG + Intronic
1181313072 22:21955958-21955980 GACATGGGGAACCACATAGAGGG - Intergenic
1181346179 22:22222030-22222052 GACATGGGGAACCACATAGAGGG - Intergenic
1183089645 22:35512882-35512904 GTGCTGTAGAACCACCTGGAAGG + Intergenic
1183432169 22:37772467-37772489 ATCTTGGGGAGCCACCTGGAGGG + Intronic
1184075774 22:42176561-42176583 CTCCTGGGGAAGCACAGAGAGGG + Intronic
951110842 3:18802046-18802068 GTCATGGGGAAGCAGCCAGATGG - Intergenic
952382419 3:32816031-32816053 GGCCTCGGGCACCACCCAGATGG + Intergenic
954778643 3:53043723-53043745 GTCCTGAGGAACTTCTTAGAAGG - Intronic
954795647 3:53160322-53160344 GTCCTGGGGAACCACCTAGAAGG - Intronic
961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG + Intronic
962385833 3:134931536-134931558 GTCCTCTGGAACCACCTTCAGGG + Intronic
965547629 3:169932210-169932232 TTCCTGGGGAACCACCCACTGGG - Intronic
969343933 4:6559649-6559671 GCCCTGGGGAAACAATTAGAAGG + Intronic
969860084 4:10028778-10028800 GTCCTAGGGAACCTGCTGGATGG + Intronic
972370518 4:38419273-38419295 CTACTGGGGCACCACCTAGTGGG - Intergenic
977357896 4:95969592-95969614 GCCCTGGGGCACCATCTGGAGGG - Intergenic
977839629 4:101687106-101687128 GTCCTGTGGATTCACATAGATGG + Intronic
978058523 4:104306126-104306148 CTCCTGGGTATCTACCTAGAGGG - Intergenic
980368636 4:131838913-131838935 CTACTGGGGCACCACCTAGTGGG + Intergenic
983077028 4:163338523-163338545 GATGTGGGGTACCACCTAGAAGG - Intronic
985791944 5:1933548-1933570 GTCCTGGGGCCCCACCTGCATGG - Intergenic
989140282 5:38195043-38195065 GTCCTGGGGGGACATCTAGATGG - Intergenic
994303177 5:98171314-98171336 GTCCTGGTAAACAACCTATAAGG + Intergenic
995024694 5:107406378-107406400 GGCCTGGAGAAGCACCAAGAAGG - Intronic
996311937 5:122116322-122116344 GTCCTGTGGAAACACATAGAAGG + Intergenic
998464089 5:142329286-142329308 GTTCTGGGGAACCTTCTTGAGGG - Intergenic
1003140639 6:3468585-3468607 AGCCTAGGGGACCACCTAGAGGG - Intergenic
1006053968 6:31367025-31367047 GTCCTGGGCATCCACCTCCAGGG + Intergenic
1007754511 6:44090301-44090323 GTGCTGAGAGACCACCTAGAAGG + Intergenic
1016294866 6:142563629-142563651 AAACTGGGGAACAACCTAGACGG + Intergenic
1021646668 7:22795915-22795937 CTACTGGGGCACCACCTAGTCGG - Intergenic
1022534163 7:31085492-31085514 GTCCTGGGGAACCAAGGGGATGG - Intronic
1023188924 7:37558471-37558493 TTCCTGGGGAAACCTCTAGAGGG + Intergenic
1028202579 7:87979235-87979257 GCAATGGGGAACCAGCTAGATGG + Intronic
1033252541 7:139773576-139773598 GTCTTGGGGAACCACCTTTGAGG - Intronic
1033341729 7:140497408-140497430 GTCCTGTGGACCCACCCAGAGGG - Intergenic
1034561698 7:151884309-151884331 GTCCTTGAGAACCACCTGCATGG - Intergenic
1036225050 8:6950771-6950793 GTCCTGGAGAACACCGTAGAGGG - Intergenic
1039801129 8:40955463-40955485 GACTTGTGGAACCTCCTAGAGGG - Intergenic
1041118027 8:54559674-54559696 GGCCTGGGGAAACCCCTGGAGGG + Intergenic
1042480446 8:69296611-69296633 GACCTGGTGAACATCCTAGAAGG - Intergenic
1047597276 8:126391577-126391599 ATGCTGGGAAACCACCTAGATGG + Intergenic
1047782765 8:128123372-128123394 GGCCTGGGGACCCAGGTAGATGG - Intergenic
1052772612 9:32703553-32703575 TTCCTGGGCTTCCACCTAGAGGG + Intergenic
1052782528 9:32795862-32795884 CTACTGGGGCACCACCTAGTGGG - Intergenic
1057014761 9:91642089-91642111 GTCTTGGGGAACACCCTGGAGGG + Intronic
1061875152 9:133539883-133539905 GCCCTGGGGACCCACCTTGCAGG + Intronic
1185946710 X:4385020-4385042 GTCCTGTGGCCCCACCCAGAAGG + Intergenic
1189588562 X:42487687-42487709 GTCCTAGAGAACCACCAGGAGGG + Intergenic
1199317802 X:146400799-146400821 CCACTGGGGAACCACCTAGTGGG + Intergenic