ID: 954795899

View in Genome Browser
Species Human (GRCh38)
Location 3:53161273-53161295
Sequence TCCGCGCGGCGGGCGGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 414}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954795899_954795911 7 Left 954795899 3:53161273-53161295 CCGGCGCCCGCCCGCCGCGCGGA 0: 1
1: 0
2: 3
3: 58
4: 414
Right 954795911 3:53161303-53161325 GCCACACCTCACTGGCCGCTTGG 0: 1
1: 0
2: 1
3: 6
4: 102
954795899_954795908 -1 Left 954795899 3:53161273-53161295 CCGGCGCCCGCCCGCCGCGCGGA 0: 1
1: 0
2: 3
3: 58
4: 414
Right 954795908 3:53161295-53161317 AGGCCCGGGCCACACCTCACTGG 0: 1
1: 0
2: 0
3: 17
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954795899 Original CRISPR TCCGCGCGGCGGGCGGGCGC CGG (reversed) Exonic