ID: 954796178

View in Genome Browser
Species Human (GRCh38)
Location 3:53162163-53162185
Sequence CACCCTGGGAGGGGTCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 1, 2: 2, 3: 25, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954796178_954796185 -6 Left 954796178 3:53162163-53162185 CCTCTGAGACCCCTCCCAGGGTG 0: 1
1: 1
2: 2
3: 25
4: 227
Right 954796185 3:53162180-53162202 AGGGTGGCCCCTGCCCGATACGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954796178 Original CRISPR CACCCTGGGAGGGGTCTCAG AGG (reversed) Intronic
900078081 1:834185-834207 TTCCCTGAGAGGTGTCTCAGTGG + Intergenic
900395514 1:2451721-2451743 CCCCCAGGGAGGGGTCCCATTGG - Intronic
900438022 1:2640706-2640728 CACCCAGGGAGGGGCTTCTGGGG + Intronic
900461701 1:2804968-2804990 TACCCTGGGAGGGCACTCTGGGG - Intergenic
900534187 1:3168939-3168961 CACCCTGGGCGTGGCCACAGGGG - Intronic
900787759 1:4659432-4659454 ATTCCTGGAAGGGGTCTCAGAGG - Intronic
902245198 1:15116249-15116271 CACGCTTTGAGGGTTCTCAGAGG - Exonic
903324032 1:22559464-22559486 CACTCTGTGAGGGGTCTCAAAGG - Intergenic
903811829 1:26038964-26038986 CAGCCAGGGTGGGGACTCAGCGG - Exonic
904576678 1:31509424-31509446 CTCCCTGGGAGGGGGGCCAGAGG - Intergenic
905386901 1:37611335-37611357 CTCTCAGGGAGGTGTCTCAGAGG - Intronic
907269293 1:53281211-53281233 CACTCGGGGAGGGGGCTTAGAGG - Intronic
907474265 1:54695222-54695244 CCACCTGGGTGGGATCTCAGAGG - Intronic
907488417 1:54792995-54793017 CAGCCTGGGAGGAGGCTCACAGG + Intronic
912548110 1:110465743-110465765 GAGCCTGTGAGGGGTCTCAGGGG + Intergenic
915007842 1:152656408-152656430 CACCTTAGGAGGGCTCTTAGGGG - Intergenic
915650509 1:157307225-157307247 GCTCCTGAGAGGGGTCTCAGGGG - Intergenic
917141551 1:171841058-171841080 CACCCTGGGAGGAGTCATCGCGG + Intergenic
917658038 1:177147231-177147253 CACCCTGGAAAGGGTATCATCGG + Intronic
919453967 1:197801422-197801444 CTCCCTGGGTGGGGTTTCACTGG - Intergenic
919923529 1:202180239-202180261 CTCCCTGGCAGGGGTGTCCGGGG - Intergenic
920434850 1:205941067-205941089 CAAGCTGGCTGGGGTCTCAGTGG + Intronic
922894914 1:229092437-229092459 TCCCCTTGGAGGGCTCTCAGAGG - Intergenic
924515261 1:244760513-244760535 GACCCTGGGGCTGGTCTCAGGGG + Intergenic
924741706 1:246797868-246797890 CAGGCTGGGAGGAGCCTCAGAGG + Intergenic
1064705684 10:18070092-18070114 CATCCTGTGAGGGGAATCAGGGG + Intergenic
1065882645 10:30049729-30049751 CACCATGGGAGGGATTACAGAGG + Intronic
1066058012 10:31699454-31699476 CACCATGGGAGGGATCTGAATGG + Intergenic
1069633981 10:69914228-69914250 AGCTCTAGGAGGGGTCTCAGTGG - Intronic
1069723069 10:70561763-70561785 CACCCTGGGAGGGGGTTCCCTGG + Intronic
1069728863 10:70598535-70598557 CACACTGGCATGGGTCTCGGGGG + Exonic
1069735515 10:70651510-70651532 CACCCTTTAAGGGGTCTCACAGG + Intergenic
1069753892 10:70761706-70761728 CAGCCTGGAAGGGGACTCTGTGG + Exonic
1070819500 10:79346746-79346768 CACCCTGGGAGGGGACTCAGTGG - Intergenic
1070855182 10:79603033-79603055 CATCCTGTGAGGGGGATCAGGGG - Intergenic
1072484027 10:95837371-95837393 CACTCTGGGAGGTTTCTCAAGGG + Intronic
1072503839 10:96044284-96044306 CCCCCGGGGAGGGGGCGCAGAGG + Intronic
1073998707 10:109345608-109345630 CTCCCTGGCAGTGGGCTCAGTGG + Intergenic
1075969881 10:126643391-126643413 CAGCTTGGGAGGGGCCACAGAGG - Intronic
1076009631 10:126977198-126977220 CAGCCTGAGAGGGGTGCCAGGGG + Intronic
1076031635 10:127164065-127164087 CAACCTGGGTGGCGTCCCAGGGG + Intronic
1076496300 10:130899867-130899889 CAGCCTCGGTGGGGTCCCAGTGG - Intergenic
1077343617 11:2036749-2036771 CACCAAGTGACGGGTCTCAGGGG + Intergenic
1078105396 11:8355142-8355164 CAGCATGGGAAGGGTCTCTGTGG - Intergenic
1084361310 11:68670120-68670142 CTTCCTGGGAGGGGCCTCAGGGG - Intergenic
1085692343 11:78674061-78674083 CACCCTGAGGGGAGTCACAGCGG - Intronic
1089325057 11:117651272-117651294 CACCCTGGCAGGGGCTGCAGTGG + Intronic
1090416428 11:126543689-126543711 CACCATGGGAGAGGTTTCCGTGG - Intronic
1202826603 11_KI270721v1_random:91938-91960 CACCAAGTGACGGGTCTCAGGGG + Intergenic
1091826974 12:3520130-3520152 CACTCTGGGAGGGGACTCAGTGG - Intronic
1092398102 12:8146318-8146340 CTCGCTGGGAGGGGTGGCAGAGG - Intronic
1092491379 12:8949057-8949079 CACCCTGGGAGAGCTTTGAGGGG - Intronic
1093115969 12:15211517-15211539 GTCACTGGGAGGGGTATCAGTGG + Intronic
1095992339 12:48044555-48044577 CACCCAGGGAGCGGTTTCAGTGG - Exonic
1096007555 12:48184698-48184720 CTCCCTGTGAGGGGACTCCGTGG + Exonic
1096071020 12:48775615-48775637 CACCCTGGGATGGGGCTGGGGGG - Intronic
1096078896 12:48820836-48820858 CACCCTGGGATGGGAATCACAGG - Intronic
1096509946 12:52122128-52122150 CACCGTGGGAGGGGGCTTGGAGG - Intergenic
1096609159 12:52789770-52789792 CACCCAGGGAGGGGACTCCGGGG + Exonic
1101338068 12:103814352-103814374 CTTCCCGGGAGGGGTCTCAAAGG + Intronic
1102266608 12:111491421-111491443 CACCCTAGCTGGTGTCTCAGTGG - Intronic
1103699825 12:122843232-122843254 CCGCCTGGGAGGGGCCTGAGGGG + Intronic
1105516508 13:21095499-21095521 TCCCCTGGGAGGGGTGGCAGAGG - Intergenic
1108478112 13:50841417-50841439 GACCCTGGAAGGCTTCTCAGAGG - Intronic
1109991321 13:70061069-70061091 CAGGCTGGGAGGGGTCACTGGGG + Intronic
1112182968 13:97103484-97103506 CACCCTGGAATGGGCCTCAGAGG - Intergenic
1113806970 13:113115619-113115641 CACCCTGAGAGGGGCTTCTGGGG - Intronic
1113839427 13:113350363-113350385 CACTCTGGGAGTGGCCTCAGAGG + Intronic
1116114912 14:40635700-40635722 CACCCTGGTTGGTGTCTCACCGG - Intergenic
1119435535 14:74595493-74595515 CAGGCTGGGAGGGGTCCCTGGGG + Intronic
1119705589 14:76780930-76780952 CGCTCTGGGAGGAGACTCAGTGG - Exonic
1121036059 14:90704583-90704605 CAGCCTGGGAAGGCTCCCAGCGG + Intronic
1122287708 14:100661704-100661726 TAACCTTGGAGGGCTCTCAGAGG + Intergenic
1122352556 14:101104447-101104469 AAACCTGGGAAGGGTCTCAAAGG - Intergenic
1122810893 14:104287382-104287404 CACCCAGAGAGGTGTCGCAGGGG - Intergenic
1122822700 14:104355174-104355196 CACCCTCGGGCGGGCCTCAGGGG - Intergenic
1122880582 14:104689052-104689074 CACCCTTGATGGGGTCTCGGCGG - Intergenic
1128249540 15:66154797-66154819 GAACCTTGGTGGGGTCTCAGTGG + Intronic
1128251098 15:66164917-66164939 CCACCAGGGAGGGGGCTCAGGGG + Intronic
1129110874 15:73336302-73336324 CACCCTGAGTGGGGTCTCCCTGG + Intronic
1129683152 15:77669611-77669633 GACCCTGGGAGCAGTCCCAGAGG - Intronic
1131103748 15:89715328-89715350 ATGCCTGGGAGTGGTCTCAGTGG - Intronic
1131537028 15:93245971-93245993 CACTCTGGGAGGTCTCTCAGTGG + Intergenic
1132597483 16:760043-760065 CATGCTGGGAGGGGTTTCAGGGG + Intronic
1132684658 16:1157274-1157296 CCCCCTGGGAGGCGTCTCCCGGG + Intronic
1132859263 16:2062006-2062028 CACCCAGGAGGGGGTCTCACAGG - Exonic
1133168349 16:3964721-3964743 CACCCCAAGAGGGGTCTGAGTGG - Exonic
1134279299 16:12803669-12803691 CACCCGGGGAGGGGACTCTGGGG - Intronic
1137621052 16:49876777-49876799 CGCCCCGGGAGGCGTCTGAGAGG + Intergenic
1137787243 16:51149940-51149962 CAATCTCGGCGGGGTCTCAGCGG - Intronic
1140112824 16:72018255-72018277 CATCCTGGAAGGAGTTTCAGAGG - Intronic
1141657498 16:85423890-85423912 CATCCTGGATGGGGCCTCAGGGG - Intergenic
1141738537 16:85873049-85873071 CATCCTGGGATGGTTCTTAGGGG - Intergenic
1142033972 16:87852396-87852418 CAGCCTGGGAGGGGCCACAGGGG + Intronic
1142272773 16:89099351-89099373 CTCCCTGGGAGGGGTCGCGCGGG - Intronic
1143864105 17:9911496-9911518 CTTCCTGGGAGGTGTCTCTGGGG - Intronic
1144093753 17:11881465-11881487 CACTCTGGGAGAGGTTGCAGAGG + Intronic
1145256144 17:21323529-21323551 CAGCCTGGGAGGGGCGTCGGAGG + Intergenic
1145320469 17:21764421-21764443 CAGCCTGGGAGGGGCGTCGGAGG - Intergenic
1145935009 17:28710136-28710158 CACCCTGGCTGAGGTCCCAGCGG - Intronic
1146791010 17:35750483-35750505 CCCCCTAGGAGGGGTCTGGGCGG + Intronic
1147309194 17:39584277-39584299 CACTTTGGGAGGGGGCTGAGGGG + Intergenic
1147429340 17:40362006-40362028 CTCCCTGGGCGGGGTCTCTTGGG + Intronic
1147559489 17:41500142-41500164 GAGGCTGGGAGGGGCCTCAGTGG + Intergenic
1147670122 17:42172046-42172068 GGCCCTGGGAGGGGACTCTGAGG - Intronic
1148090439 17:45019845-45019867 CAACCTTGGAGGGGTCTGAAGGG + Intergenic
1148492197 17:48030498-48030520 CTGCCTTGGAGGAGTCTCAGTGG - Intronic
1149866825 17:60155872-60155894 CACCCTGCAAGGGGTGTCACTGG - Intronic
1151684458 17:75638633-75638655 CCCCCCGGGACGGGTCTCACTGG - Exonic
1152186838 17:78862461-78862483 CTCCCTGGGAGGGGGAGCAGGGG - Intronic
1152506842 17:80755058-80755080 CACCCTGGGAGGGGCCAGAGGGG + Intronic
1152806484 17:82359293-82359315 CTCCCGAGGAGGGGTCTCTGAGG + Intronic
1152865602 17:82720974-82720996 CGACCTGGGAGGCCTCTCAGTGG - Intronic
1153243954 18:3055570-3055592 CACTTTGGCAGGGGTATCAGAGG - Intergenic
1157522128 18:48352543-48352565 CAGCCAGGGATGGGGCTCAGGGG + Intronic
1157624791 18:49042304-49042326 CATCCCGGGTGGGGTCCCAGAGG - Exonic
1160716650 19:579808-579830 ACCCCAGGGAGGGGTCTGAGGGG + Intronic
1160928743 19:1559817-1559839 GACCCTGGGAGGGGTGGCGGGGG + Intronic
1161289050 19:3483136-3483158 CACCCTGGGTGGGTGGTCAGGGG - Intergenic
1161648160 19:5467252-5467274 CAGCCTGGGAGTGGCCTCAGCGG - Intergenic
1161835798 19:6645468-6645490 GACCATGGCAGGGGTCACAGAGG - Intergenic
1162817456 19:13204659-13204681 CACCATGGGAGGGGGACCAGAGG + Intergenic
1163373274 19:16914495-16914517 CACCCTGCAAGGGGACTCACAGG + Exonic
1163493819 19:17633034-17633056 CAGCCTTGGAGGGGACACAGAGG + Intronic
1163627018 19:18396153-18396175 CACTTTGGCAGGTGTCTCAGTGG + Intronic
1165247360 19:34505147-34505169 CAGCCTGGGTGGGGGCTCAGAGG + Exonic
1165545207 19:36529409-36529431 CGCCATGGGAGGGCTATCAGAGG - Intergenic
1165882536 19:39053864-39053886 CACCCCGGGAGGGTTCTGGGCGG - Intergenic
1167601734 19:50458884-50458906 AACACAGGGAGGGGGCTCAGCGG - Intronic
926339149 2:11890429-11890451 CAGCCTGGAAGGGGGATCAGGGG - Intergenic
927422123 2:22944580-22944602 CCCACAGGGAGGGGACTCAGTGG + Intergenic
928420506 2:31134695-31134717 CACCCTTGGAGAGCTCCCAGGGG - Intronic
932211054 2:69930882-69930904 CTCCCTGGGAGGGCTGTCATGGG - Intronic
932406146 2:71513636-71513658 CCCCCTGGGCTGGGTCCCAGGGG + Intronic
932480759 2:72037575-72037597 CAGCCTGGGAGGGGAGGCAGAGG + Intergenic
935082070 2:99807912-99807934 CAGCCTGGGAAGGGGCTCAGGGG - Intronic
935672861 2:105570592-105570614 GACCCTGTGATGGGACTCAGTGG - Intergenic
938135210 2:128750969-128750991 CACCCTGGGATGCCTCCCAGAGG - Intergenic
939296582 2:140273581-140273603 CACCCTTGGTGAGCTCTCAGCGG + Intronic
940021720 2:149163027-149163049 CATCTTGAGAGGGGTCTCTGTGG + Intronic
943627542 2:190216863-190216885 CGCTCTGGGAGGGGACTTAGTGG - Intronic
944322561 2:198365121-198365143 CACCCTGAGATGGGTAACAGGGG + Intronic
948673895 2:239585656-239585678 CAGCCTGTGGGGAGTCTCAGGGG + Exonic
1169113071 20:3045791-3045813 CACGCAGGGAAGGGTCTCAGCGG - Intergenic
1169959253 20:11140641-11140663 CACCCTCTGAGGTGTCTGAGTGG + Intergenic
1170797622 20:19562994-19563016 CACCCTGAGAAGGTGCTCAGGGG - Intronic
1172002483 20:31790384-31790406 CATCCTGGGAGGGATCCCAAAGG - Intronic
1173706200 20:45111990-45112012 CACCCAGGCAGGGGGCTGAGGGG - Intronic
1174197876 20:48786179-48786201 CTCCCTGGGAGGGGTCCTGGTGG + Intronic
1174503150 20:51000217-51000239 CGCCCAGGGAGAGGTCTCAGAGG - Intergenic
1175311798 20:58017631-58017653 CACCCTGGTGGGGGGCCCAGGGG - Intergenic
1175415867 20:58800593-58800615 CAGCATGGGAGGGGTTTCTGAGG + Intergenic
1175930931 20:62493410-62493432 GACCCTGGGAGGGAAATCAGAGG + Intergenic
1175975270 20:62707757-62707779 CACCCTGTGAGGACACTCAGAGG + Intergenic
1176139893 20:63540353-63540375 CACCCTGGGAGGGAGTCCAGGGG + Intergenic
1176426988 21:6553933-6553955 CACACTTGGAGGGCTGTCAGAGG + Intergenic
1178608422 21:34058731-34058753 CACCCTCAGAGGGGGCACAGAGG + Intergenic
1178845670 21:36172205-36172227 CTCCCTGGGAGGAAGCTCAGTGG - Intronic
1178880632 21:36447390-36447412 CACTCTGGGAGTGGTCAGAGAGG + Intergenic
1178960726 21:37062318-37062340 CAACCTGGGAGAGGTATCAGTGG - Intronic
1179702479 21:43162255-43162277 CACACTTGGAGGGCTGTCAGAGG + Exonic
1180172977 21:46070089-46070111 CACCCTGGGAAAGGTGGCAGGGG + Intergenic
1181026565 22:20130943-20130965 CACCTAGGGAGGGGTCTAATGGG + Intronic
1181311480 22:21947116-21947138 CACCCTGGGAGGAGGCTGTGAGG - Intronic
1183295654 22:37027876-37027898 CACACTGGCTGGGGGCTCAGTGG - Intronic
1184030698 22:41892753-41892775 TTCCCAAGGAGGGGTCTCAGGGG - Intronic
1184384706 22:44167494-44167516 CACCATGGGAGTGGAGTCAGAGG + Intronic
1184475772 22:44720496-44720518 CTGCCTGGAAGGGGTCTCACAGG + Intronic
1184554131 22:45223936-45223958 CACCCTGGGTGCTGGCTCAGTGG - Intronic
1185365909 22:50436649-50436671 CACCCAGGGCTGGGTCTCTGAGG + Intronic
950102560 3:10367002-10367024 CAGGCTGGGAGGCCTCTCAGGGG - Intronic
950575314 3:13828711-13828733 CAACCTCAGAGGGGTTTCAGAGG - Intronic
951268404 3:20597361-20597383 GACTCTGTGAGGGTTCTCAGAGG + Intergenic
953251588 3:41249339-41249361 CACACTGGGAAGGATCTCAGTGG + Intronic
953268861 3:41419900-41419922 CACCCTGTGAGGGGTCACAGTGG - Intronic
954796178 3:53162163-53162185 CACCCTGGGAGGGGTCTCAGAGG - Intronic
961361104 3:126367609-126367631 CACACAAGGAGGGGCCTCAGAGG + Intergenic
962905124 3:139794532-139794554 CAACCTGGGAGAGTGCTCAGAGG + Intergenic
965266827 3:166554173-166554195 TACCCTGGCAGGGATCCCAGGGG - Intergenic
967877268 3:194275857-194275879 GACCTGGGGAGGGGTCTGAGAGG - Intergenic
969524281 4:7696218-7696240 CACCCAGGGTGGGGCCTCTGGGG + Intronic
969631936 4:8343936-8343958 CACTCTCAGAGGGATCTCAGGGG - Intergenic
969998891 4:11343872-11343894 CAGCCTGGGCGGGTACTCAGGGG + Intergenic
970601225 4:17642320-17642342 CAGCCTGGGCGGGGTGCCAGTGG - Intronic
970604352 4:17665611-17665633 GATCCTGGGAGGTGTCTCAGGGG + Intronic
972355922 4:38279563-38279585 CAGCCTCGCAGGGGTCTCTGTGG - Intergenic
975459243 4:74631175-74631197 CAGCCTGGGAAGGGGCACAGAGG - Intergenic
977574172 4:98659045-98659067 TACCCTGGAAGGGGTGTCGGGGG - Intergenic
978738207 4:112107933-112107955 CAGGCAGGGAGGAGTCTCAGGGG + Intergenic
984208617 4:176817798-176817820 CACCCTGGAAGGGTCCACAGAGG - Intergenic
986430234 5:7674040-7674062 CCCGCTGGCAGGGGCCTCAGAGG + Intronic
992934458 5:81687495-81687517 CACCCTGGCTGGTGTCTCACTGG - Intronic
997549366 5:134738587-134738609 CAGTCTGGGAGGGGTGGCAGTGG - Exonic
998957853 5:147454854-147454876 CACTGTGGGTGGGGTCTGAGTGG + Intronic
999197424 5:149791998-149792020 AGCCATGGGAGGGGTGTCAGTGG + Intronic
999250015 5:150176942-150176964 CACCCAGGGAGGAGTCACAAAGG + Intronic
999319005 5:150601717-150601739 CCCCCTGGGAGGGTCCTCTGGGG + Intronic
1001401325 5:171448231-171448253 CACCCTGGGGGGAATCCCAGTGG + Intronic
1002201513 5:177531401-177531423 CACCCTGGGCGGGATCCCTGGGG - Intronic
1003516688 6:6824191-6824213 CACACTGGCAGGGGTCTCCAAGG + Intergenic
1003963294 6:11229360-11229382 CAGCCCGGGCGGGGGCTCAGCGG - Intronic
1005869747 6:29966032-29966054 AGCCCTGGGAGGGGACTTAGTGG - Intergenic
1006068343 6:31478533-31478555 CACCATGGAAGGGGTGGCAGAGG - Intergenic
1006114226 6:31766657-31766679 CATCCTTCGAGGGGTCCCAGAGG - Exonic
1013179596 6:107706938-107706960 GAGCCTGGCATGGGTCTCAGTGG - Intronic
1015146734 6:129995676-129995698 CACCCTGTGAGGGGACTTTGAGG - Intergenic
1015352717 6:132241556-132241578 CATTCTGGAAGGGCTCTCAGAGG + Intergenic
1015702411 6:136050922-136050944 CAGCCTGGGAAGCGTCTGAGAGG - Intronic
1016520591 6:144942420-144942442 CCCCCAGGCAGGGGTGTCAGAGG + Intergenic
1018472102 6:164106425-164106447 CACCCAGGGAGGGGCCCCACGGG - Intergenic
1018976969 6:168573543-168573565 CAGCCTGGGAGGAGGCGCAGAGG + Intronic
1019568531 7:1696990-1697012 CAGGCTGGGAGGCTTCTCAGAGG + Intronic
1019915775 7:4131320-4131342 CAGCCTGGGAGAGGGCTCAGGGG + Intronic
1020259229 7:6521373-6521395 CAGCCTGGGCAGGGTCTCTGGGG + Intronic
1020280922 7:6649619-6649641 GCCCCTGGGAAGGGTCCCAGAGG - Intronic
1020445449 7:8262386-8262408 CACCCTGGGAGGGGTCGCTCCGG - Intronic
1021580241 7:22144565-22144587 CACCCAGGGATGAGGCTCAGGGG + Intronic
1024506403 7:50165829-50165851 CTTCCTGGGAGGGGTCCCAATGG - Intergenic
1024548461 7:50541094-50541116 CAGCCTGAGAGGGGTCTGAATGG - Intronic
1026299998 7:69089520-69089542 CACCCAGGGAAGGTGCTCAGAGG + Intergenic
1026562938 7:71465360-71465382 CACCCTTTGGGGGGTGTCAGAGG + Intronic
1026770884 7:73198002-73198024 CTCACTGGGAGGGCTCTTAGAGG - Intergenic
1027011751 7:74751399-74751421 CTCACTGGGAGGGCTCTTAGAGG - Intronic
1027076289 7:75194652-75194674 CTCACTGGGAGGGCTCTTAGAGG + Intergenic
1029509131 7:100982327-100982349 CACCATGTGTGGGGTCCCAGAGG - Intronic
1029529312 7:101114753-101114775 CCCCCAGGAAGGGGACTCAGGGG + Intergenic
1029593886 7:101526445-101526467 CCCTCTGTGAGAGGTCTCAGAGG - Intronic
1030508703 7:110456430-110456452 GACGCTGGGAGAGGTATCAGTGG + Intergenic
1034396938 7:150833459-150833481 GAGCCTAGGAGAGGTCTCAGAGG - Intronic
1035527538 8:325484-325506 TTCCCTGAGAGGTGTCTCAGTGG - Intergenic
1036655659 8:10675466-10675488 CACCCATGGATGGTTCTCAGTGG - Intronic
1036947262 8:13106012-13106034 CAGCCTGGGAGGGTCCTTAGGGG - Intronic
1037622084 8:20573105-20573127 CTCCCTGGAAGAGGTCTCTGAGG + Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1040716518 8:50259997-50260019 AAACCTGGTAGGGCTCTCAGTGG - Intronic
1047200331 8:122759920-122759942 CATCCTGGGAGGGGATTGAGAGG + Intergenic
1047212836 8:122853781-122853803 TGCCCTGGGAGGGGTGACAGTGG - Intronic
1048843975 8:138589303-138589325 CACACTGGGAAGGGTCACATTGG + Exonic
1049057909 8:140253718-140253740 CACCTTGGGAAGGGCCTCCGGGG + Intronic
1049434308 8:142579408-142579430 CAGCATGGGAGGGCTCTCTGTGG + Intergenic
1052844460 9:33322709-33322731 CGCCCTGGGAAAGGTCTCTGAGG - Intronic
1053293330 9:36896464-36896486 CACCCTGGGAGGTGCCTCTGTGG - Intronic
1054759158 9:68989372-68989394 AAACCTGGAAGGGGTCGCAGAGG + Intronic
1056751560 9:89355355-89355377 CACCCTGGGAGGGAACACAGTGG - Intronic
1057481633 9:95449261-95449283 CACGCTGGGGGGTGGCTCAGGGG + Exonic
1057546428 9:96022561-96022583 CACCCTGGCAGGGGCTTCCGCGG + Intergenic
1060917347 9:127398908-127398930 CACCCAGGGAGGGGCCTGAGTGG - Intronic
1061448900 9:130658273-130658295 CACCTGGGGAGTGGTCTCTGGGG + Intergenic
1062133820 9:134914320-134914342 GTCCAGGGGAGGGGTCTCAGAGG - Intronic
1062211406 9:135366227-135366249 CATCCAGGCAGGGGGCTCAGTGG - Intergenic
1186370880 X:8946344-8946366 CAACCTGGAAGGGGCCTCGGTGG - Intergenic
1190517807 X:51243173-51243195 TACCCTGGCAGTGGTGTCAGTGG + Intergenic
1190761419 X:53441033-53441055 CACACTGGCAGGGGTTTCACTGG - Intergenic
1192045914 X:67674323-67674345 TACCCAGGGAGTGGTCTCTGTGG - Intronic
1199622557 X:149713378-149713400 AACCCAGGGAGGAGTCCCAGAGG + Intronic
1201896414 Y:18997290-18997312 CAACCTGGCAGGGGTCTGGGTGG + Intergenic