ID: 954797409

View in Genome Browser
Species Human (GRCh38)
Location 3:53168606-53168628
Sequence CTGTGAAATGGGCAGATCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 272}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954797402_954797409 -8 Left 954797402 3:53168591-53168613 CCCCACTTGCCTCGTCTGTGAAA 0: 1
1: 2
2: 35
3: 550
4: 3607
Right 954797409 3:53168606-53168628 CTGTGAAATGGGCAGATCACGGG 0: 1
1: 0
2: 1
3: 14
4: 272
954797401_954797409 -3 Left 954797401 3:53168586-53168608 CCGTTCCCCACTTGCCTCGTCTG 0: 1
1: 0
2: 3
3: 20
4: 271
Right 954797409 3:53168606-53168628 CTGTGAAATGGGCAGATCACGGG 0: 1
1: 0
2: 1
3: 14
4: 272
954797403_954797409 -9 Left 954797403 3:53168592-53168614 CCCACTTGCCTCGTCTGTGAAAT 0: 1
1: 0
2: 6
3: 65
4: 448
Right 954797409 3:53168606-53168628 CTGTGAAATGGGCAGATCACGGG 0: 1
1: 0
2: 1
3: 14
4: 272
954797400_954797409 9 Left 954797400 3:53168574-53168596 CCAGGGACTGGACCGTTCCCCAC 0: 1
1: 0
2: 1
3: 6
4: 181
Right 954797409 3:53168606-53168628 CTGTGAAATGGGCAGATCACGGG 0: 1
1: 0
2: 1
3: 14
4: 272
954797404_954797409 -10 Left 954797404 3:53168593-53168615 CCACTTGCCTCGTCTGTGAAATG 0: 1
1: 1
2: 9
3: 128
4: 742
Right 954797409 3:53168606-53168628 CTGTGAAATGGGCAGATCACGGG 0: 1
1: 0
2: 1
3: 14
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954797409 Original CRISPR CTGTGAAATGGGCAGATCAC GGG Intronic
900456603 1:2777936-2777958 CTGTTAAATGGGCATGTCCCTGG + Intronic
901657368 1:10777157-10777179 CTGTGAAGAAGGCAGCTCACAGG - Intronic
901935735 1:12625451-12625473 CTGTGAAATGGGAACAGCAATGG - Intergenic
902639884 1:17760394-17760416 CTGTGAAATGGGTTTTTCACAGG + Intronic
903282183 1:22256294-22256316 CTATGAAATGGACAGAAAACGGG - Intergenic
904468396 1:30721288-30721310 CTATGAAATGGCCACCTCACGGG + Intronic
906319529 1:44807699-44807721 TTGTGGAATGGCCAGATGACTGG + Intergenic
906506079 1:46380663-46380685 CTGTAAAATGGGGATAACACTGG - Intergenic
906790966 1:48658576-48658598 CTGTGAAATGGGCAGAGTTGGGG - Intronic
906942783 1:50271027-50271049 CTCTGAGATAGACAGATCACAGG + Intergenic
909908253 1:81225921-81225943 CATTGAAATGTGCAGTTCACCGG - Intergenic
910144669 1:84065591-84065613 TTGTGAAATGGGAATATAACAGG + Intergenic
910501667 1:87899117-87899139 CTGGGAATTTGCCAGATCACTGG + Intergenic
911069556 1:93821811-93821833 CTGTGAAATGGGCATAATAATGG - Intronic
912405318 1:109433068-109433090 CTGTGAAAGGGCCAGACCATTGG - Intergenic
913246249 1:116872711-116872733 CCCTGAAATGGGCAGATCTGGGG - Intergenic
916082094 1:161240395-161240417 CTGAGATGTAGGCAGATCACAGG + Intergenic
916329704 1:163600909-163600931 CTGTGGAATGGCCAGATAGCTGG + Intergenic
916951941 1:169789535-169789557 CTGAGAAATGGGCAGTTTAAAGG + Intronic
918045060 1:180936470-180936492 CTGTGATGGGGGCAGCTCACAGG - Exonic
919197922 1:194312690-194312712 CTGAGAAATAGGAAGATCATGGG - Intergenic
919373201 1:196758146-196758168 ATGTGAAATGAGCACATCATGGG + Intergenic
923412833 1:233726692-233726714 TTGTGACATGGCCAGATAACTGG + Intergenic
1063313387 10:4978119-4978141 CTGGGAAAGGGGCAGGTGACAGG + Exonic
1063314565 10:4989598-4989620 CTGGGAAAGGGGCAGGTGACAGG - Exonic
1064214250 10:13386328-13386350 CTGTGAGATGGGCAGAACCCTGG - Intergenic
1064917943 10:20483284-20483306 CTGAGAAATGTGGAGATAACAGG + Intergenic
1065146517 10:22773705-22773727 CTGTAAAATGGGGATAGCACTGG + Intergenic
1069078610 10:64064664-64064686 CTGTGAAATGGGGATAACAAGGG - Intergenic
1069646251 10:70000251-70000273 CTGAGAAACGGGCAGGTCAATGG + Intergenic
1073688854 10:105785484-105785506 CTGTAAAATGGGGAGATCTGTGG + Intergenic
1073849440 10:107597630-107597652 CTGGGGAATGGGCAGTTTACGGG - Intergenic
1074346646 10:112692802-112692824 CTGTGATGTGTGCAGACCACTGG - Intronic
1074353189 10:112758147-112758169 CTGTGGAATGGGAAGTTCTCAGG + Intronic
1077039798 11:514949-514971 CTTGGAACTGGGCAGAACACAGG + Intergenic
1077420405 11:2447339-2447361 CTGTGAAGTGGCCAGATCTGGGG + Intronic
1079497002 11:21056122-21056144 CTGTGATCTGGGCAAATTACTGG - Intronic
1079519954 11:21314686-21314708 CTGTGAAACAGGCAGAGGACAGG + Intronic
1079722604 11:23837122-23837144 CTGTAAAATGTGCAGATCTTTGG + Intergenic
1083192119 11:61059739-61059761 CTGTGAAGTGGGCAGGGCAGAGG - Intergenic
1084498530 11:69520428-69520450 CTTTGAAATGACCAGATCTCAGG + Intergenic
1084765575 11:71306000-71306022 CAGGGAAATGGGCAGACCTCAGG + Intergenic
1085055396 11:73400268-73400290 CTCTGAGATGGGCAGAACATGGG + Intergenic
1086029713 11:82339469-82339491 CTGTGAATTGGAGAGAACACTGG - Intergenic
1089533651 11:119148292-119148314 CTGAGAAAGGGGCAGAGCAGGGG + Intergenic
1090455928 11:126849750-126849772 GTGTGAAATGGGCAGCACCCAGG + Intronic
1091659608 12:2373549-2373571 CTCTGAACTGGGCAGAGCAATGG + Intronic
1092234987 12:6801279-6801301 GTTTGAGGTGGGCAGATCACCGG + Intronic
1095183205 12:39170457-39170479 CTGTTAAAGGGGTAGATCTCAGG + Intergenic
1095226594 12:39685436-39685458 CTTTTAAATGACCAGATCACAGG + Intronic
1097209259 12:57352822-57352844 CTGGGAATTGAGCAGATCAATGG + Intronic
1099620562 12:84997807-84997829 CTGTGAAATCTGCAGATGTCAGG + Intergenic
1100765593 12:97862245-97862267 CAGTGAAATTGGCAAACCACAGG + Intergenic
1100819869 12:98420860-98420882 CTGGGAGATGGGCAGGTGACAGG + Intergenic
1103465288 12:121137706-121137728 CTGTGAAATGGGTAGACCCATGG + Intronic
1103663843 12:122545359-122545381 CAGTGAAGTGGGGTGATCACAGG - Intronic
1104269668 12:127271844-127271866 ATGTGAAATGTGCAGATCGTGGG + Intergenic
1104435025 12:128748835-128748857 CTGTGAAGTGGGCAGGACAGTGG + Intergenic
1105256048 13:18744637-18744659 CAGTGCAACGGGCAGATCTCAGG + Intergenic
1105632939 13:22189214-22189236 CAGGGAACTGGGCAGCTCACTGG + Intergenic
1105752042 13:23429970-23429992 GGCTGAAGTGGGCAGATCACTGG + Intronic
1105972930 13:25447483-25447505 TTGTGGAATGGGAAGCTCACAGG + Intronic
1106715477 13:32383781-32383803 GAGTGAACTGGGCAGATCAAAGG + Intronic
1107341715 13:39414180-39414202 GGGTGAAATTGCCAGATCACAGG + Intronic
1108715927 13:53077764-53077786 CTTTTAAATGGTCAGATCTCAGG + Intergenic
1108891011 13:55259273-55259295 CTGTGAGATGGGTAGAGCTCAGG - Intergenic
1110291563 13:73813639-73813661 CAGTGAAATGGCCAGAGCTCTGG - Intronic
1112147462 13:96717017-96717039 CTGTGAAATGTGGAGCTCAGAGG + Intronic
1112278615 13:98043656-98043678 GGCTGAAGTGGGCAGATCACTGG - Intergenic
1112877670 13:104065085-104065107 CTGTGAATTAGGCATAACACTGG - Intergenic
1113458544 13:110465859-110465881 CTTTGAAATGGGCAGGGAACGGG - Intronic
1114851876 14:26391972-26391994 CAGTGAAATGGGAAGCTCACTGG - Intergenic
1115100895 14:29698114-29698136 CTTTGAAATGGGGAGACAACAGG - Intronic
1115502623 14:34062996-34063018 CTGTGAAATGGGGATAACAGTGG + Intronic
1118066228 14:62193583-62193605 GTGATAAATGGGCAGAACACAGG - Intergenic
1118247266 14:64123397-64123419 CTGGGAAATTGGGAAATCACGGG - Intronic
1121704247 14:95979501-95979523 CTGTAAAATGGGCATATCACAGG - Intergenic
1123216592 14:106813826-106813848 CTGAGAAATGGGAAGACCACAGG + Intergenic
1123216603 14:106813882-106813904 CTGAGAACTGGGAAGACCACAGG + Intergenic
1124433889 15:29632028-29632050 CAGGGAAATGGGCAGCCCACAGG - Intergenic
1125336585 15:38632415-38632437 GGCTGAGATGGGCAGATCACTGG - Intergenic
1125412168 15:39416832-39416854 CTATGAAAGGGGAAGAACACAGG - Intergenic
1126098335 15:45104763-45104785 TTGTGCAATGGGCAAATCATAGG - Intronic
1128107284 15:65054382-65054404 CTGTGAAGTCAGCAGATGACAGG + Exonic
1128317995 15:66673270-66673292 CTGTGTAATGTGAAAATCACCGG + Intronic
1129234447 15:74215478-74215500 CTTTGAAATGTGCAGCTCAGTGG - Intergenic
1129300966 15:74625234-74625256 TTGTGAATTGGGGAGCTCACTGG + Intronic
1129411284 15:75351945-75351967 CTGTTAAATGGGAACATCAAGGG - Intronic
1131613176 15:93986397-93986419 CAGTTAAATGGGCTGAGCACAGG + Intergenic
1131643840 15:94320656-94320678 CAGTGAAATGGGCACTACACTGG + Intronic
1132362043 15:101224555-101224577 CTGTCAACAGCGCAGATCACTGG + Intronic
1133963913 16:10517725-10517747 CTGTCAAAATGGCAGATCCCAGG + Intergenic
1134375294 16:13666600-13666622 CTCTGGAGTGGGCAGTTCACTGG + Intergenic
1135614318 16:23897708-23897730 CTGTGAAATGCGGAGAAGACTGG + Intronic
1135914838 16:26596525-26596547 CTGAGAAATGGACACATCAGAGG - Intergenic
1137732454 16:50698696-50698718 CTGTAGAATGGGTAGATCATAGG + Intronic
1137865655 16:51893449-51893471 CTGTGCAAAGAGCAGATTACAGG + Intergenic
1142561457 17:811744-811766 CTGTGAGATGGACAGCTCAAGGG + Intronic
1142687217 17:1584383-1584405 CTGTAAAATGGGTATAACACTGG + Intronic
1143029020 17:3957215-3957237 CTGTAAAATGGGCATAACAATGG - Intronic
1143534129 17:7525643-7525665 TTGTGACATGGCCAGATAACTGG + Intergenic
1144517416 17:15928290-15928312 CAGAGAAATGGGGAGATCATCGG + Intergenic
1146935621 17:36810921-36810943 CTGTGAAATGGACAGCTCTGAGG - Intergenic
1146959355 17:36959927-36959949 GTATGAAATGGGAAGATAACAGG - Intronic
1147315004 17:39615855-39615877 CTGGGAAATGCCCAGGTCACAGG - Intergenic
1152073766 17:78146672-78146694 CTGCGAAATGGGCGGATGAGAGG + Intronic
1152239319 17:79153244-79153266 CAGGGAAATGGGGTGATCACAGG - Intronic
1154114843 18:11604286-11604308 CTTTTAAATGAGCAGATCTCAGG - Intergenic
1154434984 18:14336041-14336063 CAGTGTAATGGGCAGGTCTCAGG - Intergenic
1155634284 18:27934034-27934056 CTGTGAAATAGTGAGATGACTGG + Intergenic
1156735527 18:40253879-40253901 CAATAAAAAGGGCAGATCACTGG + Intergenic
1157427525 18:47596479-47596501 CTGTGAAATGAGCAGAAGTCAGG - Intergenic
1159721128 18:71892225-71892247 AGTTGAAATGGCCAGATCACAGG + Intergenic
1159829764 18:73261531-73261553 TTGTGAATTGGGCAGGCCACGGG - Intronic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1161175722 19:2841333-2841355 CTGTAAATTGGGCAGTTCCCCGG - Intergenic
1161435019 19:4258075-4258097 CTGTGAAATGGACACAGCGCTGG + Intronic
1161625102 19:5321941-5321963 TTGTGAAATGGGGACATCTCAGG - Intronic
1162070165 19:8148392-8148414 CTGTGAAATGGGCACAGAAGCGG - Intronic
1162339815 19:10085862-10085884 CTGTGAAATGGGGAGAATCCTGG - Intergenic
1162873771 19:13605752-13605774 CTGTGAAATGGGAAGAAGAATGG - Intronic
1165202069 19:34153302-34153324 CTAAGGGATGGGCAGATCACTGG + Intergenic
1165863913 19:38924375-38924397 CTGTGAAGTGGGATGATAACAGG + Intronic
1166586246 19:43951749-43951771 CTGAGAAATGGTCAGGTCCCTGG + Intronic
1168200005 19:54807671-54807693 GGCTGAAGTGGGCAGATCACTGG - Intronic
1168209884 19:54882672-54882694 GGCTGAAGTGGGCAGATCACCGG - Intronic
924975200 2:167061-167083 CTGTGAAATGTGCAAATCATTGG - Intergenic
926288770 2:11511799-11511821 CTGTGAACTGGGGAGAACAGGGG + Intergenic
926335800 2:11861758-11861780 CTGTGGAGTGGGCAGGGCACTGG + Intergenic
926554579 2:14341958-14341980 CTGAGAGCTGGGCAGATGACAGG + Intergenic
926695759 2:15769408-15769430 CTGTGAGATGGGGTCATCACAGG - Intergenic
927279515 2:21291665-21291687 CTGTGGAATGTGAAGATCATAGG - Intergenic
927869952 2:26617036-26617058 CTGTAAAATGGGTAGAGCAGTGG - Intronic
927871728 2:26628383-26628405 CTGTAAAATGGGTAGAGCAGTGG - Intronic
928199083 2:29235658-29235680 CTGTCAGCTGGGCAGAGCACAGG + Intronic
929409395 2:41680073-41680095 GGCTGAAATGGGAAGATCACCGG - Intergenic
929598643 2:43191517-43191539 CTGTGGAAGGGGCAGTGCACAGG - Intergenic
929727354 2:44444831-44444853 CTGTGACATGCCCAGATAACTGG - Intronic
929910233 2:46083529-46083551 CTGTGGAATGGGCACTTCAGTGG + Intronic
931900216 2:66780116-66780138 CTTTTAAATGGCCAGATCTCAGG + Intergenic
933276481 2:80289681-80289703 CTGTAAAATGGTCATATCAGTGG - Intronic
934519523 2:95011074-95011096 CTCTGCAGTGGGCAGATGACGGG + Intergenic
938177942 2:129153326-129153348 CTCTGAAATGTGCTGATTACAGG - Intergenic
941356866 2:164504538-164504560 CTGTAAAATACCCAGATCACAGG - Intronic
942579413 2:177401421-177401443 CTGTGAAATGGGCAGTTGTGAGG - Intronic
942626920 2:177911521-177911543 CTTTGAAAAGGGCGGAACACTGG - Intronic
942645721 2:178108679-178108701 CTTTTAAATGTGTAGATCACAGG - Intergenic
946435089 2:219646113-219646135 CTGTGAGATGGGCAGAGACCTGG + Intergenic
947481586 2:230505398-230505420 CTGCTAAATGGTAAGATCACAGG + Intronic
947872344 2:233446378-233446400 CTGTGAAATGCTCATCTCACTGG + Intronic
1169005229 20:2201102-2201124 CTGTGAAATGCTCAGGTAACTGG + Intergenic
1172221179 20:33276116-33276138 TTGGGAAATGGGCAGGTCCCTGG - Intronic
1172613510 20:36268164-36268186 CTGTGACCTGGGCAAGTCACTGG + Intronic
1174362439 20:50037409-50037431 CTGTGAAATGGGCATGGCCCTGG - Intergenic
1174637951 20:52018011-52018033 CATTGAAGTGGGCAGATCAGTGG + Intergenic
1176842053 21:13849661-13849683 CAGTGCAATGGGCAGGTCTCAGG + Intergenic
1177781805 21:25630063-25630085 CTGTGAAAAGGGGACATCACGGG - Intergenic
1178144452 21:29722319-29722341 GGCTGAGATGGGCAGATCACAGG + Intronic
1178207352 21:30485447-30485469 CTGTTAAATAAGCAGATCTCGGG - Intronic
1178303969 21:31474940-31474962 CGGTGAAATGGGAAGATAATTGG + Intronic
1178988729 21:37333299-37333321 ATGTGAAATAAGCACATCACAGG + Intergenic
1181404075 22:22669411-22669433 CTGTGAAGGGGGAACATCACTGG - Intergenic
1182463871 22:30502306-30502328 CTGTGTAATGGGCATAATACTGG - Intronic
1182620801 22:31617485-31617507 CTGTGATCCAGGCAGATCACGGG + Intronic
1182648027 22:31826240-31826262 GGCTGAGATGGGCAGATCACAGG - Intronic
1183032844 22:35118289-35118311 CTGTGAAATGGGCAAAGCCAGGG + Intergenic
1183515038 22:38260498-38260520 CTGTGAAATCCGCAGAACTCTGG + Intronic
1183780047 22:39993849-39993871 CCGTGAAAGAGGCAGAGCACGGG - Intergenic
1184973517 22:48044822-48044844 CTGTGCAATGCGCAGAGCAGTGG + Intergenic
950306789 3:11921504-11921526 TTGGGAGGTGGGCAGATCACGGG - Intergenic
950514977 3:13459226-13459248 CTGTGAAAATGGCAGAGAACAGG - Intergenic
951795541 3:26534152-26534174 CTGTGGATTGCGAAGATCACAGG + Intergenic
952567382 3:34675294-34675316 ATGTGAAATAAGCACATCACGGG - Intergenic
953761762 3:45693633-45693655 CAATGAAATGGAAAGATCACTGG - Intronic
954797409 3:53168606-53168628 CTGTGAAATGGGCAGATCACGGG + Intronic
955320415 3:57970328-57970350 CTGTGAAATGGGGATAACAATGG + Intergenic
956040899 3:65143881-65143903 CTGTGAAATGGGGATAACAACGG - Intergenic
956428790 3:69164072-69164094 GGCTGAAATGGGAAGATCACCGG - Intergenic
958536525 3:95411367-95411389 CTGTGACATGCCCAGATAACTGG - Intergenic
960737562 3:120797368-120797390 TTGTGAAAAGGGCAGGTCCCAGG - Intergenic
960934807 3:122891738-122891760 CTGTGCAATGGTCAGAGCAGAGG + Intergenic
961741488 3:129035867-129035889 CTGTGAAATGGGCATAATAATGG + Intronic
961812076 3:129527750-129527772 CAGTGGCTTGGGCAGATCACTGG - Intergenic
962536506 3:136333947-136333969 CTTTGAAATGATCAGAACACAGG - Intronic
964737453 3:159931298-159931320 CTGTCAGATCAGCAGATCACAGG - Intergenic
966625554 3:182012469-182012491 CTGTGAAATGGGCAGATGGTGGG - Intergenic
967955252 3:194872774-194872796 CTGTGGAATGGGAACCTCACCGG - Intergenic
967991760 3:195136725-195136747 AGGTGAAGTGGGCAGCTCACAGG + Intronic
968108343 3:196020224-196020246 CTGTGAAATGTGCAAATCATTGG - Intergenic
968707676 4:2089393-2089415 CTGTGAAACTGACAGATGACTGG + Intronic
968794682 4:2694847-2694869 CTGTGAAATGGGCAGGACAGTGG + Intronic
968976862 4:3826650-3826672 CTGTGAAATGGGGCCATGACTGG - Intergenic
970748881 4:19333666-19333688 CAGTCGAATGGGCAGCTCACAGG - Intergenic
970844255 4:20517242-20517264 CTGAGACATGGGCAGATGATGGG + Intronic
971848735 4:31955540-31955562 CTGTGAAGTTGGAAGAGCACAGG + Intergenic
973938724 4:55880849-55880871 CTGTGAAAAGCTCAAATCACAGG - Intronic
976674115 4:87685523-87685545 CTGTGAAATGGTGAGTCCACTGG - Intergenic
978383230 4:108152761-108152783 CTGTTAAAAAGGCAGATTACTGG - Intronic
978976728 4:114885201-114885223 CTGGGAAATGGACAGTTGACAGG - Intronic
979443868 4:120787279-120787301 ATGTGAAATGGGCAGAGAAGTGG + Intronic
979454945 4:120916684-120916706 GTTTGAAGAGGGCAGATCACGGG - Intronic
982425658 4:155256027-155256049 TTGTGAAAAGGGTAGATCTCAGG + Intergenic
983607650 4:169608238-169608260 TTATGAAATAGGCAAATCACAGG + Intronic
984228716 4:177066916-177066938 CTGTGTAATGGGCAGCACACTGG - Intergenic
989426727 5:41304208-41304230 GTGCTAAGTGGGCAGATCACTGG + Intergenic
990964100 5:61425923-61425945 GTAAGAAATGGGCAGATAACTGG + Intronic
996021336 5:118593966-118593988 CTCTGGAATGGGAAGATCATAGG + Intergenic
996554297 5:124762284-124762306 GGCTGAAGTGGGCAGATCACTGG - Intergenic
997889005 5:137658526-137658548 CTGTAAAATGGGCATATTAAAGG + Intronic
999318027 5:150596665-150596687 CTGTGGGAGGGGTAGATCACTGG - Intergenic
1000192350 5:158923738-158923760 CAGTGAAATGGGCTGGGCACTGG - Intronic
1001088242 5:168717249-168717271 CTGTGAAATGGGGATAACAGCGG + Intronic
1001091139 5:168741852-168741874 CTGTGAAATGGGGATAACAGCGG - Intronic
1001292417 5:170473364-170473386 CTATAAAATGGGCATAACACTGG - Intronic
1001715961 5:173816284-173816306 TCTTGAAATGAGCAGATCACTGG + Intergenic
1002558466 5:180062855-180062877 CTGTAAAATGGCCAGTTAACGGG - Intronic
1003329961 6:5121621-5121643 CTGGGAACTGGGCAGAACTCAGG + Intronic
1004769824 6:18769192-18769214 GAGTGAAATGGGAAGATTACAGG + Intergenic
1004796098 6:19086680-19086702 CTGTGAACTGCGCAGAGCAGAGG + Intergenic
1004813152 6:19281970-19281992 TTGTGAATTTGGCAGGTCACAGG - Intergenic
1004937318 6:20520186-20520208 CTGGGAACTGGGTAGATCAAGGG + Intergenic
1006687471 6:35848319-35848341 GGCTGAAGTGGGCAGATCACTGG + Intronic
1007549183 6:42715997-42716019 CTGTGCAGTGGGCACTTCACCGG - Intronic
1011269513 6:85562825-85562847 GGCTGAGATGGGCAGATCACTGG - Intronic
1014899158 6:126942199-126942221 CTGTAAAATGGGGATAACACTGG + Intergenic
1015379634 6:132551651-132551673 CTGTGAGAAGGGCAAATCCCTGG + Intergenic
1015612344 6:135037238-135037260 CTGTGAAACTGGCAGATGACTGG + Intronic
1017028620 6:150201976-150201998 TTGTGAAATGAGCAGAGCAAAGG - Intronic
1021048541 7:15953805-15953827 CTGAGAAATGGGGAGACTACTGG + Intergenic
1024048234 7:45599859-45599881 GGCTGAGATGGGCAGATCACAGG - Intronic
1024437926 7:49381109-49381131 CTGTGACATGCCCAGATAACTGG - Intergenic
1025218077 7:57077057-57077079 GGCTGAGATGGGCAGATCACGGG + Intergenic
1025628993 7:63250682-63250704 GGCTGAGATGGGCAGATCACGGG + Intergenic
1027308609 7:76929121-76929143 CTGAGAATTGTGAAGATCACTGG - Intergenic
1028242334 7:88436755-88436777 CAGTGAAAATGGGAGATCACTGG - Intergenic
1029592386 7:101515822-101515844 GGCTGAAGTGGGCAGATCACTGG - Intronic
1033732146 7:144190607-144190629 CTGTAAAATGGGCAGAATAATGG - Intronic
1033742996 7:144289192-144289214 CTGTAAAATGGGCAGAATAATGG - Intergenic
1033750906 7:144360422-144360444 CTGTAAAATGGGCAGAATAATGG + Intronic
1035076608 7:156181862-156181884 CTGGGAAAGGGGAAGAGCACTGG - Intergenic
1035551080 8:526231-526253 GGCTGAGATGGGCAGATCACTGG - Intronic
1035959616 8:4122740-4122762 CTGTGAAAGGGGAAGATTTCTGG + Intronic
1037687583 8:21156552-21156574 GGCTGAGATGGGCAGATCACTGG + Intergenic
1040075285 8:43223105-43223127 CTGAGAAATGGTGAGGTCACAGG - Intergenic
1040488987 8:47901906-47901928 CTCTGAAATGGCCTGTTCACTGG + Intronic
1042835300 8:73074447-73074469 CTGTGAAATGGGGAAATAATAGG - Intronic
1043091714 8:75912796-75912818 GGGTGAAGTGGGCAGATCGCTGG + Intergenic
1043400183 8:79876960-79876982 CTGTGAAAGGGGCTGTTCTCTGG + Intergenic
1043742969 8:83837032-83837054 GGCTGAGATGGGCAGATCACCGG + Intergenic
1046503708 8:115111271-115111293 CTGAGAGATGGGCAGATAATGGG - Intergenic
1046830811 8:118743846-118743868 CTGTGAAAAGGACAGATTCCTGG - Intergenic
1046855928 8:119032014-119032036 CTGTAAAATGGGGAGAATACTGG - Intronic
1048878911 8:138857465-138857487 CTGTGAAATAGGGAGACCATAGG - Intronic
1049238758 8:141525911-141525933 CTGCGAAATGGGGGGATGACGGG - Intergenic
1049362111 8:142216758-142216780 CTGTAAAATGGGCAGATACTTGG + Intronic
1050522346 9:6514296-6514318 ATGTGAAATAAGCACATCACAGG + Intergenic
1050929653 9:11307512-11307534 CTGTGACATGTGCAGATGACTGG - Intergenic
1051091862 9:13419184-13419206 TTGTTAAATGGGCACACCACTGG - Intergenic
1055633442 9:78248454-78248476 CTGGGAAGGGGGAAGATCACTGG - Intronic
1056067850 9:82955681-82955703 ATGTGAAATGAGCACATCATGGG + Intergenic
1056253934 9:84778940-84778962 CTATGAAAAGGGCATCTCACTGG - Intronic
1057534739 9:95889525-95889547 CTGTAAAATGCACAGATCTCAGG + Intronic
1058952273 9:109915069-109915091 CTGGGAAATGGGAAGATCTGGGG - Intronic
1059131918 9:111761264-111761286 GGCTGAAGTGGGCAGATCACTGG + Intronic
1060205702 9:121681581-121681603 CTGTGAAATGGGCACACTAATGG - Intronic
1060801713 9:126549366-126549388 CTGTGGAATGGGCAGGTCTCTGG - Intergenic
1061271794 9:129547945-129547967 CTGTAAAATGGGCACATTACTGG + Intergenic
1061547725 9:131314457-131314479 GTGTGAGGTGGGCGGATCACGGG - Intergenic
1061872530 9:133528467-133528489 CTGTAAAATGGGGAGAACAGAGG - Intronic
1062182377 9:135197468-135197490 CTGTGAAATGGGGATATCCCAGG + Intergenic
1062483285 9:136762309-136762331 CTGTGAACTCAGCAGCTCACAGG + Intronic
1186357704 X:8804328-8804350 CTGTCAAATGAGCAGAGGACAGG + Intergenic
1186617791 X:11207834-11207856 CTGTCAAATGAGCAGAGGACGGG - Intronic
1186876570 X:13823929-13823951 CTGCCAAATGGGCACAGCACAGG + Intronic
1187004209 X:15215939-15215961 CTGTCTCATGGGCAGATCTCAGG + Intergenic
1188179698 X:27039487-27039509 CTGAGAAATTGTCAGACCACAGG - Intergenic
1188551111 X:31365550-31365572 CTATCAAATGGCCAAATCACAGG - Intronic
1189616610 X:42790223-42790245 TTGTGAAATGCCCAGATAACTGG + Intergenic
1190120866 X:47658468-47658490 CTGTGAAATGGGGAGTTTTCTGG - Intronic
1192489965 X:71567686-71567708 CTCTGTAATGGGCACACCACAGG + Exonic
1193375849 X:80759910-80759932 CTGTGAAATGTGAAAAACACTGG - Intronic
1196027388 X:111055306-111055328 ATGTGCAATGGCCAGATCATGGG - Intronic
1196563351 X:117176970-117176992 CTGTGACATGCCCAGATAACTGG - Intergenic
1197138446 X:123089955-123089977 CTTTAAAATGACCAGATCACTGG + Intergenic
1198576656 X:138017517-138017539 CTGTAAAATGGGCAGAATAGTGG - Intergenic
1199043517 X:143141444-143141466 CTGTGATATGCCCAGATAACTGG + Intergenic
1199064704 X:143401329-143401351 GTGTGAAATGTGTAGGTCACGGG + Intergenic
1199500183 X:148499855-148499877 CTGAGAAATGGGAAAACCACTGG - Intergenic