ID: 954803413

View in Genome Browser
Species Human (GRCh38)
Location 3:53200842-53200864
Sequence GCATCTACTAAGGGCAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954803409_954803413 30 Left 954803409 3:53200789-53200811 CCTACTGGTAGCGTCTGGGGCAT No data
Right 954803413 3:53200842-53200864 GCATCTACTAAGGGCAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954803413 Original CRISPR GCATCTACTAAGGGCAGATC TGG Intergenic
No off target data available for this crispr