ID: 954806306

View in Genome Browser
Species Human (GRCh38)
Location 3:53222873-53222895
Sequence TGCCCTACACACACCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954806301_954806306 1 Left 954806301 3:53222849-53222871 CCCTTCATGGCAGGACCCAGATC 0: 1
1: 1
2: 0
3: 10
4: 147
Right 954806306 3:53222873-53222895 TGCCCTACACACACCCATCTTGG 0: 1
1: 0
2: 1
3: 10
4: 146
954806302_954806306 0 Left 954806302 3:53222850-53222872 CCTTCATGGCAGGACCCAGATCC 0: 1
1: 0
2: 2
3: 17
4: 264
Right 954806306 3:53222873-53222895 TGCCCTACACACACCCATCTTGG 0: 1
1: 0
2: 1
3: 10
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954806306 Original CRISPR TGCCCTACACACACCCATCT TGG Intergenic
901534723 1:9874755-9874777 TGCAATATCCACACCCATCTAGG + Intronic
903178367 1:21593492-21593514 TCCCCTACCCACCCCCAGCTGGG - Intergenic
905706899 1:40067392-40067414 TGTCCTACCCATACCCAACTTGG - Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
908063357 1:60375282-60375304 TGCTCTACCCACTCCCATTTAGG - Intergenic
910259264 1:85279950-85279972 TTCCTTACACACAGCCATCCAGG + Intergenic
910317472 1:85902671-85902693 TGCCCTACACACTCATATGTGGG + Intronic
914812438 1:151038749-151038771 TCCAACACACACACCCATCTTGG + Intronic
915233068 1:154460269-154460291 GGCCCTGCTCACACCCATCCAGG + Intronic
916750960 1:167722290-167722312 GGCCCGACACACGCCCATCGCGG + Intronic
917844531 1:179009421-179009443 TGCCCCTCAGACACTCATCTAGG - Intergenic
919543962 1:198888869-198888891 TGCCCAAAATACACACATCTGGG + Intergenic
919587340 1:199455181-199455203 GGCGCTTCCCACACCCATCTGGG + Intergenic
1067088587 10:43255318-43255340 TGCCCCACCCACTGCCATCTGGG + Intronic
1069447127 10:68483696-68483718 TGCAATCCACACTCCCATCTGGG - Intronic
1071466831 10:85948463-85948485 TGCCCTACACACATCTCACTTGG + Intronic
1073334879 10:102699142-102699164 TGTTGTACCCACACCCATCTTGG - Intronic
1073996316 10:109318984-109319006 TCCCCAACTCACACACATCTAGG - Intergenic
1074074460 10:110110283-110110305 TACACGACCCACACCCATCTTGG - Intronic
1075447917 10:122526633-122526655 TGACCTACCCAGACCCATCCAGG + Intergenic
1075732468 10:124644695-124644717 TTCCCTACCCACAGCCATGTGGG - Intronic
1085171583 11:74454161-74454183 TTCCTTACACACACCCAGGTTGG - Intergenic
1089747664 11:120628454-120628476 TGACCACCAGACACCCATCTGGG + Intronic
1091187730 11:133661605-133661627 TCCCCTCCACACAGCCGTCTGGG - Intergenic
1091385301 12:90967-90989 TGCCCCATCCCCACCCATCTTGG - Intronic
1093737261 12:22635323-22635345 TGGTCTACACACACCCTTCTTGG - Intronic
1094489587 12:30950832-30950854 TCCCCTACACACACACATTGAGG + Intronic
1098735972 12:74105766-74105788 TGCCCTACACAGACCTAGGTAGG + Intergenic
1100895527 12:99178265-99178287 TGGCCTACAGACACCCCTGTGGG - Intronic
1101797009 12:107984269-107984291 TCACATACACAGACCCATCTAGG + Intergenic
1103313088 12:120027958-120027980 TGCCTTAAAAACACCCATTTAGG - Intronic
1106139004 13:26995067-26995089 TGCCACACACACAGCCACCTCGG + Intergenic
1108598735 13:51972523-51972545 TCCCCATCACACACCCCTCTTGG + Intronic
1109156589 13:58918432-58918454 TGGCCTAAAGACACACATCTCGG + Intergenic
1110696887 13:78501518-78501540 TGCCCCACACACACACACCTTGG + Intergenic
1111572768 13:90108343-90108365 TGGCCTACACGCACCCCTGTCGG - Intergenic
1112591028 13:100763142-100763164 TGCCCTACTCACACCCACATTGG - Intergenic
1112917795 13:104572589-104572611 CACCCTCCACACACCCAGCTTGG - Intergenic
1113081583 13:106525973-106525995 CGCCCTACACAAACCTTTCTGGG - Intronic
1118327519 14:64791700-64791722 TGCCCTACCCACACCCCACCTGG + Exonic
1119332661 14:73806702-73806724 TCCGCTTGACACACCCATCTCGG + Intergenic
1122344483 14:101050065-101050087 TGCCCTTCACACACCCACAGAGG - Intergenic
1123048630 14:105530262-105530284 CGCCCTCCACACACCCCTCCTGG - Intergenic
1123212835 14:106777412-106777434 TTCCCCACACAGAACCATCTCGG - Intergenic
1128153278 15:65376818-65376840 TTCCCCACAGACACTCATCTGGG - Intronic
1128368791 15:67024108-67024130 TGCCCTTCACACTCCTACCTGGG - Intergenic
1128614907 15:69101353-69101375 TGCCCTTGGCACACACATCTTGG + Intergenic
1129056701 15:72825618-72825640 AGCCCTACACACATCCCACTCGG - Intergenic
1130817964 15:87460472-87460494 TGCCCTACCCACATCCCTCAGGG + Intergenic
1131188558 15:90294871-90294893 TGCCCCACCCCCACCCTTCTTGG - Intronic
1132546269 16:534796-534818 TGCCCCCCACACCCCCAGCTCGG + Intronic
1135853083 16:25982237-25982259 TGCCCTTCACTCACCCAGCTGGG + Intronic
1137673465 16:50292359-50292381 GGCCCTCCACACAGCCAGCTGGG + Intronic
1203143054 16_KI270728v1_random:1781507-1781529 TCCAATAGACACACCCATCTGGG - Intergenic
1203143062 16_KI270728v1_random:1781545-1781567 TCCAATAGACACACCCATCTGGG - Intergenic
1203143070 16_KI270728v1_random:1781583-1781605 TCCAATAGACACACCCATCTGGG - Intergenic
1203143082 16_KI270728v1_random:1781659-1781681 TACAATAGACACACCCATCTGGG - Intergenic
1144204022 17:12966512-12966534 TGGCCTACACACACCCAGTGAGG - Intronic
1145005203 17:19333684-19333706 TGCCAGGAACACACCCATCTCGG - Intronic
1145877573 17:28331219-28331241 TGCCATGCACACACCTCTCTGGG - Intronic
1147401207 17:40180969-40180991 TCCCCTCCACACCCCCGTCTGGG - Intronic
1147760943 17:42796994-42797016 TCCCCTACACTCTCCCAGCTGGG - Intronic
1151305559 17:73260885-73260907 GACCCTACACTCACCCAGCTTGG + Intronic
1152499430 17:80698062-80698084 TGCCCCGCACCCACCCGTCTGGG - Intronic
1152619379 17:81354354-81354376 TGCCCCACATCCACCCATCCTGG - Intergenic
1153737936 18:8092149-8092171 TTCCCTACAAACACTCAGCTTGG + Intronic
1154004217 18:10513027-10513049 TGCCCTACACACTAGCATCCGGG + Intergenic
1155431104 18:25759640-25759662 TGCCCTCCAATCACACATCTGGG - Intergenic
1155706679 18:28824109-28824131 TTCCCTCCACCCACCCACCTAGG - Intergenic
1157586509 18:48804711-48804733 TGCCTCTCACACACCCACCTAGG - Intronic
1157682868 18:49620545-49620567 GGCCCTACCCACAGGCATCTTGG - Intergenic
1158249871 18:55475850-55475872 TGCCCTCCCCACTCCCACCTAGG - Intronic
1159328099 18:66949789-66949811 GGCCCACCACACACCCATCCTGG - Intergenic
1160695704 19:483362-483384 AGCCCTACAGACGCCCATCCTGG + Intergenic
1162569000 19:11460036-11460058 TGCCCTTGACACCCCCATGTGGG - Intronic
1165063368 19:33215755-33215777 TGCCCCACACTCACCCAGCCAGG + Exonic
1165251341 19:34538683-34538705 TGCTCTTCACACACACACCTTGG + Intergenic
1165862375 19:38915964-38915986 CGCCCTAGACCCACCCACCTTGG - Intronic
1165987032 19:39778395-39778417 AGCCCTTCACCCGCCCATCTCGG - Intronic
1166002418 19:39885762-39885784 AGCCCTCAGCACACCCATCTGGG + Exonic
1166005202 19:39902014-39902036 AGCCCTCAGCACACCCATCTGGG + Exonic
1166658607 19:44630222-44630244 AGTCCTGCACACAACCATCTAGG + Intronic
1167931416 19:52868851-52868873 TGCCCTGCACACACTGATTTAGG + Intronic
926147340 2:10404779-10404801 TGGCCTAGACACATCCAGCTGGG - Intronic
926634515 2:15165637-15165659 TGCCCTACACACAACCTGGTTGG - Intergenic
929427323 2:41856488-41856510 TTCCCTACACACATTCTTCTTGG + Intergenic
931617454 2:64174598-64174620 TGCCCTACCCAACCCCATCTTGG + Intergenic
936404902 2:112194211-112194233 TGTCCTACACACACTGTTCTAGG - Intergenic
937434584 2:121869943-121869965 TGCCCTGAGCACACCCAGCTGGG + Intergenic
938119028 2:128620926-128620948 TGCCCTACACATCCCAATCTTGG + Intergenic
940039414 2:149344643-149344665 TGCCTTACCAACACCAATCTTGG + Intronic
941732521 2:168934233-168934255 TCCACTACACCCACCCAGCTAGG - Intronic
1169213126 20:3778583-3778605 GGCCCTACACTCACCCTTCCAGG + Intronic
1169387952 20:5166964-5166986 AGCCCTACTTACAACCATCTAGG - Intronic
1172719715 20:36990339-36990361 TGACCTGCACATACACATCTAGG + Intergenic
1172782987 20:37448078-37448100 TGCCCAACACACATATATCTGGG - Intergenic
1179097114 21:38325732-38325754 TTCCCTGCACCCTCCCATCTAGG - Intergenic
1179673937 21:42969071-42969093 CCCCCTGCACACACCCATCCTGG - Intergenic
1182443321 22:30376561-30376583 AGCCCTGCACATCCCCATCTCGG + Exonic
1184250184 22:43255735-43255757 TGCCCTGAACACCCCCACCTTGG - Intronic
949503824 3:4707460-4707482 CTCTCTACACACACTCATCTTGG - Intronic
949564293 3:5230677-5230699 TGCACTAGACAGTCCCATCTGGG - Intergenic
953389674 3:42526988-42527010 TGCCCTTCAGACACCCCTCGAGG - Intronic
953741506 3:45542934-45542956 TGCCCTGAACAAACCCACCTAGG + Intronic
954653074 3:52177134-52177156 TGCCCTACACACAGGCCTCAAGG + Intergenic
954806306 3:53222873-53222895 TGCCCTACACACACCCATCTTGG + Intergenic
955475660 3:59333520-59333542 CTCCCTACACACTCACATCTAGG - Intergenic
956788664 3:72663342-72663364 TGCCCCAGAAACACCCATATGGG - Intergenic
958677075 3:97278799-97278821 TGGCCTGCACACACCCCTCATGG + Intronic
961513554 3:127419281-127419303 TGCCCTCCCCACCCCCACCTGGG - Intergenic
966118754 3:176498213-176498235 TGCCCTACACTATCCCATCTAGG + Intergenic
968477587 4:819625-819647 TGCCTGACTCACACCCAACTTGG - Intronic
969934521 4:10667621-10667643 TGCCCACCACACACCCATGCTGG + Intronic
971981425 4:33756135-33756157 TGTCCTTCACACACCCCTATTGG + Intergenic
972559383 4:40213387-40213409 TCTCACACACACACCCATCTTGG + Intronic
973058847 4:45693960-45693982 TGCCCTCCACATACCAAACTTGG + Intergenic
975365851 4:73526890-73526912 TGCCCTCCCCACACCAGTCTTGG + Intergenic
975723663 4:77271766-77271788 TGCCCCAAACCCACCCATCATGG - Intronic
976899120 4:90152317-90152339 TAACCTACACACACCAATCAAGG - Intronic
977339558 4:95741498-95741520 TTCCCTAGTCCCACCCATCTTGG + Intergenic
980346221 4:131623809-131623831 TGCCCAATACACACCCTTCCAGG + Intergenic
982356245 4:154473007-154473029 GGCCCTGGACACTCCCATCTTGG - Intronic
982441222 4:155438578-155438600 TGCCCTACACACTCTGGTCTTGG + Intergenic
989240475 5:39197399-39197421 TGCCCTAAACACACCTGACTAGG - Intronic
999721680 5:154403198-154403220 TGGCCTACACAGACCCTCCTTGG - Intronic
1003210566 6:4061010-4061032 TGGCCTGCACACACACACCTAGG - Exonic
1007524271 6:42477790-42477812 TGTCCTAAACACACCCAAGTAGG - Intergenic
1013097762 6:106961431-106961453 GCCCCTACCCACACCCAACTGGG + Intergenic
1016839956 6:148516299-148516321 TGAGCTACACACACACACCTGGG - Intronic
1017158284 6:151341778-151341800 AAACCCACACACACCCATCTCGG - Intronic
1018395538 6:163375503-163375525 TGTCCTACACACCCCAACCTCGG + Intergenic
1018856752 6:167680447-167680469 TGCCTTACACACAGCCCCCTTGG - Intergenic
1019699666 7:2468530-2468552 TGCCCCCCACACCCCCATCGCGG - Intergenic
1021144591 7:17069415-17069437 TGCCCTGCACACACCCACACAGG + Intergenic
1022522836 7:31019135-31019157 TGCCCTACCCACACCCAGGAGGG - Intergenic
1024607610 7:51035117-51035139 AGCCCTGCACACACCCGGCTGGG - Intronic
1027951550 7:84823148-84823170 TGACCTGCACACACACATCCAGG + Intergenic
1031214564 7:118873677-118873699 TGCCCTACCCACACCAGACTCGG + Intergenic
1033027391 7:137788693-137788715 TGCCATACACACACACATCTAGG + Intronic
1033206797 7:139429973-139429995 TGCCTTAAAAACACCCATATGGG - Intergenic
1034275605 7:149822507-149822529 TGCTCCACACACACTCCTCTAGG - Intergenic
1035192103 7:157179135-157179157 TGCACTGCAGACACCAATCTTGG - Intronic
1042509367 8:69595197-69595219 TGACCTTCACAAAACCATCTGGG - Intronic
1047642149 8:126832328-126832350 TCCCCTACACACACTCTTCTTGG - Intergenic
1048995222 8:139789914-139789936 GGCCCTACCCACAGCCTTCTCGG + Intronic
1057037246 9:91820393-91820415 TGCCCTGAACACATTCATCTGGG + Intronic
1057304320 9:93903544-93903566 TGGGCTCCACACTCCCATCTTGG - Intergenic
1061261076 9:129481511-129481533 TGCCCTTCACATCCCCACCTGGG - Intergenic
1061401667 9:130371851-130371873 TGCCCTCCACACACTGATCTTGG + Intronic
1062303733 9:135890159-135890181 TGCCCAACCCACACCCATGGAGG + Intronic
1185549528 X:972158-972180 TACAATAGACACACCCATCTGGG + Intergenic
1185549535 X:972196-972218 TACAATAGACACACCCATCTGGG + Intergenic
1188224099 X:27575348-27575370 GGCCCTCCACACCCCCATCCTGG - Intergenic
1189096746 X:38148680-38148702 TGCCCTCCACACACCAGACTTGG + Intronic
1190099829 X:47513932-47513954 TGCCCTACACATTCCAATTTGGG - Intergenic
1190708792 X:53050568-53050590 ATCCCTACACACACCCATCAGGG - Intronic
1194200225 X:90945335-90945357 ACCCATACACACACACATCTTGG - Intergenic
1198679338 X:139164943-139164965 TGCCCTATTCACAGCAATCTAGG - Intronic