ID: 954806381

View in Genome Browser
Species Human (GRCh38)
Location 3:53223357-53223379
Sequence GAACACTGCTAGGCAGATAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954806381_954806385 27 Left 954806381 3:53223357-53223379 CCCGTATCTGCCTAGCAGTGTTC 0: 1
1: 0
2: 0
3: 17
4: 125
Right 954806385 3:53223407-53223429 ATTCTCACAACAGCCTTGTGAGG 0: 1
1: 15
2: 113
3: 531
4: 1749

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954806381 Original CRISPR GAACACTGCTAGGCAGATAC GGG (reversed) Intergenic
904183274 1:28682269-28682291 TAACTCTGCAAGGGAGATACTGG + Intronic
907340763 1:53734597-53734619 GTAAAGTGCTGGGCAGATACTGG - Intergenic
907418129 1:54328586-54328608 AAACACTGTTAGGCTGATTCAGG - Intronic
908125656 1:61027677-61027699 CAACACTGGGAGGCAGAGACTGG + Intronic
911056674 1:93714410-93714432 GAACACTGCCTGGCACATAGTGG + Intronic
914447774 1:147764438-147764460 GAACAGTGGTAGGCACATAAAGG - Intronic
914701695 1:150139809-150139831 GAACTCTGGTAGGCCGAAACAGG - Intronic
917033486 1:170720911-170720933 GAACACTACTTGGCATATAAGGG - Intronic
917598006 1:176549232-176549254 AAACACTGATATGCAGAAACAGG - Intronic
920165223 1:204031133-204031155 AAACAAGGGTAGGCAGATACAGG - Intergenic
920723581 1:208412899-208412921 GGACACTGTGAGGCAGAGACAGG + Intergenic
921601728 1:217113373-217113395 GAACACTCCTATTCAGAAACAGG - Intronic
923710014 1:236380061-236380083 GTACACTGAGAGGCAGGTACGGG - Intronic
924317880 1:242817310-242817332 GAACTCTCCTAGGCAGATAGGGG - Intergenic
1066116449 10:32244541-32244563 GAAAAGTGCTAGACAGAAACAGG - Intergenic
1066196370 10:33104232-33104254 GAACTCTCCTAGGCAGACAGGGG - Intergenic
1070005149 10:72417040-72417062 GAAGACTGCTTGGCACATAGTGG + Intronic
1073872978 10:107887507-107887529 GAAGAATTCTAGGCAAATACTGG - Intergenic
1074472436 10:113739728-113739750 GAATACAGCTGGGCAGACACGGG + Intergenic
1081069603 11:38595035-38595057 GAACTCTCCTAGGCAGATAAAGG + Intergenic
1081393882 11:42562113-42562135 GAACACTGCCAGGCAGAGTAAGG + Intergenic
1081492889 11:43581055-43581077 GAACTCTGATAGGGAGATAGAGG + Intronic
1081676353 11:44972211-44972233 GAACCCTGCTGGGCAGAGAGTGG - Intergenic
1081771621 11:45653729-45653751 GAACAGTGCCTGGCACATACAGG - Intronic
1083680062 11:64347522-64347544 GAACACTGCTGGGTAGACATGGG + Intronic
1083927763 11:65818885-65818907 GCACTGTGCTAGGCAGATTCTGG - Intergenic
1084451210 11:69239836-69239858 GAAGACTGCTGGTCAGAAACAGG + Intergenic
1084576614 11:69992763-69992785 GAACAATGCCAGGCAGAGGCAGG - Intergenic
1084951818 11:72670674-72670696 GAACACATCTAGGCAGAGAGTGG - Intronic
1086220004 11:84430861-84430883 CACCACAGCTAGGCAGACACTGG + Intronic
1088781539 11:113138938-113138960 GACCTATGCTAGGCAGAGACTGG - Intronic
1089040439 11:115443724-115443746 GCAGACTGCTTGGCACATACTGG - Intronic
1089363784 11:117908811-117908833 GAACGCTGCCAGGCAGGTACTGG - Intronic
1095510713 12:42949026-42949048 GCACAATGCTTGGCAGATAAGGG + Intergenic
1095992917 12:48050336-48050358 GAACACTGCCAGGAACACACCGG + Intronic
1096629465 12:52916577-52916599 GTACCCTGCTGGGCAGATGCTGG - Intronic
1107217730 13:37942017-37942039 GATGACTGTTAAGCAGATACTGG - Intergenic
1108501390 13:51072675-51072697 GAAGAGTGCTTGGCAAATACGGG + Intergenic
1112323842 13:98430387-98430409 GGACACTTCCAGGCAGATAGGGG - Intronic
1114914970 14:27251898-27251920 AAACAATGATAGGCAGATTCTGG - Intergenic
1117385956 14:55212940-55212962 GAACTCTCCTAGGCAGATAGGGG - Intergenic
1117865394 14:60143081-60143103 GCACAATGCTAGGCAGGCACTGG + Exonic
1121938658 14:98045369-98045391 GAACAGTGCTAGGCACATCATGG + Intergenic
1129106263 15:73309356-73309378 GAACACTGCAAGGGCAATACTGG + Intergenic
1133861909 16:9603999-9604021 GAACACTGCTTAGCACATATAGG - Intergenic
1136393052 16:29977501-29977523 TAAAACTGCTAGGAAGATTCTGG - Intronic
1143373657 17:6455207-6455229 GGACACTGCTGGACAGACACGGG + Exonic
1143948393 17:10614260-10614282 GAACAGTGCTTGGCACATAGAGG + Intergenic
1144333995 17:14252926-14252948 GAACTCTCCTAGGCAGATAGGGG + Intergenic
1144514750 17:15909666-15909688 GAACCCTGCAAAGCAGACACAGG - Intergenic
1148205841 17:45779268-45779290 GCACACTGCCAGGCAGATCTAGG + Intergenic
1148349453 17:46929308-46929330 TAACACTGATAGGCAGATTATGG - Intronic
1148995452 17:51705474-51705496 AAACAGTGCTTGGCACATACAGG + Intronic
1149537805 17:57445947-57445969 GAACAGTGCCTGGCAGAGACAGG - Intronic
1149828440 17:59850432-59850454 CAACACTGGCAGGCAGAGACGGG + Intergenic
1149901205 17:60481108-60481130 GGATACTGCTAGGCTGTTACTGG - Intronic
1155082375 18:22423544-22423566 GAACGCTGCTTGGCACATATGGG - Intergenic
1159004295 18:62999015-62999037 CAACAGTGCCAGGCAGATAGCGG + Intergenic
1165242337 19:34478901-34478923 GAACACTGGGAGGCTGAGACGGG - Intergenic
926395444 2:12437278-12437300 GAAAGCTGTTAGCCAGATACTGG + Intergenic
926926672 2:17994803-17994825 GAACTCTCCTAGACAGATAGGGG + Intronic
926927454 2:18001949-18001971 GAACTCTCCCAGGCAGATAAGGG + Intronic
927647438 2:24886877-24886899 GGGCTCTGCTAGGCAGATGCTGG + Intronic
929431919 2:41894290-41894312 GAACATTGTTAGGCACATGCTGG + Intergenic
930024045 2:47019670-47019692 GAATACGGCTCAGCAGATACTGG - Intronic
930505581 2:52279589-52279611 GAACACAGCAAGGAAGATGCAGG + Intergenic
930509814 2:52330301-52330323 GAACACTGGTTAGCAGAGACTGG + Intergenic
932091173 2:68807711-68807733 GAACCCTGCTGGGCAGATTCAGG + Intronic
935925242 2:108061186-108061208 TAACACTGCTGGTCAGAGACAGG - Intergenic
936901051 2:117482187-117482209 GAACACTGCTAGTCTGAGACTGG - Intergenic
939884950 2:147671455-147671477 GAACACTGCCTGGCATATATTGG - Intergenic
939908588 2:147950857-147950879 TAACACTGCTAAGAAGTTACTGG + Intronic
941009607 2:160284770-160284792 CAAACCTGGTAGGCAGATACAGG + Exonic
942081151 2:172400653-172400675 GGGCACTGCTAGGGAGAAACAGG - Intergenic
946591915 2:221259545-221259567 AAACACTGCTAGGCATATCTGGG - Intergenic
1168733148 20:104465-104487 GACCACTGCTGGGGAGATAGTGG - Intergenic
1169810086 20:9601044-9601066 GAGCTCTGCAAGGCTGATACTGG - Intronic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173932000 20:46828451-46828473 GCACACTGCTTGGCAGTCACAGG - Intergenic
1176206231 20:63889723-63889745 GAACACTGCTCAGCAGGGACAGG - Intronic
1178922039 21:36745099-36745121 GAACACTGCTAGGCACAGCCTGG + Exonic
1180572440 22:16740031-16740053 GAGCACTGCAAGGCAGATCATGG - Intergenic
1184267946 22:43359940-43359962 GAACAGTGCTTGGCATATAGTGG - Intergenic
949807108 3:7967485-7967507 TACCAATGCTAGGCAGAAACAGG - Intergenic
949941121 3:9155510-9155532 GAACTCTGCTTGGCATATACTGG + Intronic
951619053 3:24580762-24580784 GAACACTGCTTGGGAGATGATGG - Intergenic
954806381 3:53223357-53223379 GAACACTGCTAGGCAGATACGGG - Intergenic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955443021 3:58977576-58977598 GAGCACTGCTTGTGAGATACAGG - Intronic
961258458 3:125579116-125579138 GATCACTGAAAAGCAGATACTGG + Intronic
968096165 3:195932271-195932293 CAACATTTCTAGGCACATACTGG + Intergenic
969728360 4:8939110-8939132 GAACTCTGCCAGGCAGAGAAGGG + Intergenic
969728369 4:8939161-8939183 GAACTCTGCCAGGCAGAGAAGGG + Intergenic
970375246 4:15450741-15450763 GAACACTGATAGGCACATCCTGG - Intergenic
972176751 4:36417467-36417489 GAACTCTCCTAGGCAGATATGGG - Intergenic
972228774 4:37045631-37045653 GCACACAGCTAGGCTGATCCAGG + Intergenic
973863057 4:55084801-55084823 GAACAGTGCTGTGCACATACTGG - Intronic
980747940 4:137044872-137044894 GCACACTGAGAGGCAGAGACAGG - Intergenic
980821064 4:138018714-138018736 GAACTCTCCTAGGCAGACATGGG + Intergenic
983239047 4:165210227-165210249 GCACAGTGCCAGGCAGAGACAGG - Intronic
984746687 4:183227169-183227191 CAACAATGCTAGGTAGATAAAGG + Intronic
986660693 5:10057422-10057444 GAGCACTGCCAGGCAGAGCCTGG + Intergenic
995043841 5:107621348-107621370 GACCACTTCTAGGCAGAGAATGG - Intronic
998520837 5:142798961-142798983 GAAAGCTGCCAGGCAGCTACTGG - Intronic
1000452022 5:161401062-161401084 GACCACTGCCAGGATGATACAGG + Intronic
1003952728 6:11131564-11131586 GAATAATGATAGGCATATACAGG + Intronic
1004633464 6:17444169-17444191 GCACAGTGCTAGACAGAGACAGG - Intronic
1005808277 6:29495387-29495409 GGAAACTGGGAGGCAGATACAGG - Intergenic
1011712542 6:90069267-90069289 GAACACTGCCATCCGGATACAGG - Intronic
1013241972 6:108254584-108254606 CAACACTGCTTGGCACATAGTGG - Intronic
1015449612 6:133350197-133350219 GAACACTGCATGGCACATAATGG - Intronic
1018118175 6:160608412-160608434 AAACACTGGAAGCCAGATACCGG - Intronic
1019917638 7:4143919-4143941 CTACACTGCTAGGCACATCCAGG - Intronic
1023335163 7:39161494-39161516 TAACCCTGCCAGGCAGATCCAGG + Intronic
1028567958 7:92253781-92253803 TACCACTGGTAGGCAGGTACAGG - Intronic
1029303309 7:99601026-99601048 GATCACTTCTAGTCACATACAGG + Intronic
1029571593 7:101373245-101373267 GATCACGGATAGGCAGAGACAGG + Intronic
1030114378 7:106051915-106051937 GCACTCTCCTAGGCAGATAGGGG - Intergenic
1030364095 7:108626665-108626687 GAACTTTGCTAGGCTGATATTGG - Intergenic
1033510008 7:142051055-142051077 GAACACTGATAGGCAGAGAAGGG - Intronic
1033512800 7:142077034-142077056 GAACACTGATAGGCAGAGAAGGG - Intronic
1034120099 7:148619339-148619361 GAACATTGCTAGGAAGATTGAGG + Intergenic
1037318621 8:17623012-17623034 GAACTCTCCTAAGCAGATACGGG - Intronic
1037744684 8:21633282-21633304 TGACACTGCTCGGCAGATAGAGG - Intergenic
1050136474 9:2470798-2470820 GAACACTGGGATGCAGATATGGG - Intergenic
1052932219 9:34065223-34065245 GAACACAGCTAGGCACATAGTGG - Intergenic
1053384820 9:37678697-37678719 GAACAGTGCCAGGCACATAGAGG + Intronic
1058539401 9:105995774-105995796 GGCCAGGGCTAGGCAGATACTGG + Intergenic
1058788639 9:108418250-108418272 GAAGACAGGTAGGTAGATACAGG + Intergenic
1058861042 9:109118289-109118311 AAACACCGCTAGACAGATAAGGG + Intronic
1060656269 9:125374623-125374645 AAACCCTGCTAGCCAGATAAAGG - Intergenic
1062262301 9:135668962-135668984 GAACACAGCTAGGGGGACACAGG - Intergenic
1186622329 X:11254497-11254519 GAACACTGCAAGTCAAATATTGG - Intronic
1186876241 X:13820804-13820826 GAACACTTCTGGGCACATAGCGG + Intronic
1189447264 X:41092433-41092455 AAACACTGTTAGGCAGAAATGGG - Intronic
1192131358 X:68554352-68554374 GACCAAAGCTAGGGAGATACAGG - Intergenic
1195405740 X:104511328-104511350 GAACAATGCTAGGCAGAGAATGG + Intergenic
1196475969 X:116086946-116086968 TAACACTGTGAGGCAGATAAGGG + Intergenic
1197329012 X:125130784-125130806 GAACACTGGCTGGCAGATAATGG - Intergenic
1200250323 X:154550023-154550045 GAAAACTCCTAGGTATATACCGG - Intronic
1201221357 Y:11773821-11773843 GAACTCTCCTAGGCAGATAGGGG - Intergenic
1201687107 Y:16717416-16717438 CAAGACTGCTTGGCAGATATTGG + Intergenic
1201907565 Y:19101207-19101229 AAACACTGCTCGGCATTTACTGG - Intergenic