ID: 954806939

View in Genome Browser
Species Human (GRCh38)
Location 3:53226040-53226062
Sequence TCATGGCTACAGGTGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954806939_954806945 26 Left 954806939 3:53226040-53226062 CCTTTCTCCACCTGTAGCCATGA 0: 1
1: 0
2: 2
3: 18
4: 240
Right 954806945 3:53226089-53226111 TTTATTTTAAAGAGACAGACAGG 0: 2
1: 1
2: 10
3: 142
4: 1077

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954806939 Original CRISPR TCATGGCTACAGGTGGAGAA AGG (reversed) Intronic
903469528 1:23576192-23576214 TCATGGCTACTGGTGGTGGGGGG + Intergenic
904981105 1:34502547-34502569 TGATGGTTGCAGATGGAGAAAGG + Intergenic
906613761 1:47221191-47221213 TCATGGTGGCAGGTGGGGAATGG + Intronic
906835779 1:49082434-49082456 TCATGGTGAAAGGTGAAGAAGGG + Intronic
909003371 1:70245678-70245700 GCATGCTTTCAGGTGGAGAATGG + Intronic
910513601 1:88035315-88035337 TCAGCTCTACCGGTGGAGAATGG + Intergenic
910629774 1:89342786-89342808 GCATGGCTACAACTGGAGGATGG + Intergenic
912619639 1:111141859-111141881 TCATGGCTACACTAGCAGAAAGG - Intronic
912759928 1:112357780-112357802 ACATGGCTAAAAGTGAAGAAAGG + Intergenic
913283381 1:117206781-117206803 GCATTGCAACAGGTGGAGATGGG + Intronic
913490314 1:119373766-119373788 ACATGCTTACAGGTTGAGAAGGG + Intronic
914169794 1:145213115-145213137 ACATAGCTAGAGGTGGAAAAGGG - Intergenic
914524909 1:148457077-148457099 ACATAGCTAGAGGTGGAAAAGGG - Intergenic
914598766 1:149178756-149178778 ACATAGCTAGAGGTGGAAAAGGG + Intergenic
914641493 1:149610057-149610079 ACATAGCTAGAGGTGGAAAAGGG + Intergenic
919300025 1:195749880-195749902 TTATAGATACAAGTGGAGAAAGG - Intergenic
919731943 1:200918611-200918633 TCAGGAGTAGAGGTGGAGAATGG - Intergenic
921239785 1:213167074-213167096 TCCTGGCCACAGTTGAAGAAGGG - Intronic
921482062 1:215674916-215674938 GCATAGCTATAGGTGGAAAAAGG + Exonic
922685722 1:227637573-227637595 TCATCGGTATAGTTGGAGAAAGG + Intronic
923944288 1:238865108-238865130 TCAGGGCTACAGCTGGACATTGG - Intergenic
924354674 1:243159346-243159368 TGATGGCTACTGGTGGAGAAGGG + Intronic
924641034 1:245834084-245834106 TCATAGGTTCAGGTGAAGAAAGG - Intronic
1067550760 10:47234227-47234249 TCTTAACTTCAGGTGGAGAAAGG + Intergenic
1068195496 10:53710646-53710668 TCAGGACTAAAGGTGGCGAATGG - Intergenic
1068304531 10:55189110-55189132 TCATGGCTACACAAGGAGCATGG + Intronic
1069039801 10:63683970-63683992 TCAGGGCTGCAGGAGTAGAAGGG + Intergenic
1069635304 10:69921415-69921437 TTATAGCTAGAGGCGGAGAAGGG + Intronic
1070036642 10:72731624-72731646 TGATGGCCACAGGTGTAGAGGGG - Intronic
1070435249 10:76385021-76385043 TTATGGCAAAAGGTGGTGAAAGG + Intronic
1073033881 10:100549492-100549514 TCAGGGCAACTGGTGGAGCATGG + Exonic
1075549484 10:123381650-123381672 TCAGGGCCACAGGAGGAGCAAGG + Intergenic
1075795748 10:125118375-125118397 TCCTGGCAACAACTGGAGAAAGG + Intronic
1077958206 11:7044150-7044172 TCATGGCTACTGGTGAGGAGTGG + Intronic
1078666326 11:13328600-13328622 GCATAGCTACAGCAGGAGAAAGG - Intronic
1080294176 11:30706130-30706152 TCATGGCTACAGAGAGAGGAAGG - Intergenic
1080604274 11:33851703-33851725 ACATGGCCACTGGTAGAGAATGG + Intergenic
1080825778 11:35847777-35847799 TCATGGCTACAGGGGAAGCCAGG - Intergenic
1081615033 11:44585736-44585758 ACAGGGCCACAGGTAGAGAAAGG + Intronic
1083610763 11:64003116-64003138 TTCTGGCCACAGGTGGAGGAAGG - Intronic
1084606199 11:70173557-70173579 CCATGGCCAGAGGTGGAGCAAGG + Intronic
1088652839 11:111973560-111973582 TGATAGCTACAGGTGGCTAATGG + Intronic
1089046501 11:115505267-115505289 TCAAGGCTTCAGGTGAAGAGCGG + Intergenic
1089064199 11:115650081-115650103 TCATGGCTTGTGCTGGAGAAGGG + Intergenic
1089374869 11:117986991-117987013 TGGGGGCTACAGGTGGAGCAAGG - Intronic
1089554806 11:119310501-119310523 TCAGGGCCACAGGAAGAGAAGGG + Intronic
1089973972 11:122716692-122716714 ACCTGCCTTCAGGTGGAGAAAGG - Intronic
1090056180 11:123426993-123427015 GCCTGGCTGCAGGTGGGGAAAGG + Intergenic
1090886640 11:130882782-130882804 ACATGGCTTGAGGTGAAGAAAGG - Intronic
1091721901 12:2820074-2820096 TCATGCCCACAGATGGAGATGGG + Exonic
1091745905 12:2992662-2992684 TCAAGGCTAGTGGGGGAGAAGGG + Intronic
1099742862 12:86663663-86663685 TGATGGTCACTGGTGGAGAAAGG + Intronic
1099783986 12:87237141-87237163 TCATGGCAATAGGGGGAGCAGGG - Intergenic
1100591855 12:96036884-96036906 TCATGGCAGAAGGTGAAGAAGGG + Intronic
1103219899 12:119235241-119235263 TCATTGCTACCTCTGGAGAAAGG - Intergenic
1104270359 12:127277956-127277978 GCATGGCTCCTGGTGGAGAGTGG + Intergenic
1104897468 12:132171435-132171457 TCTTGGCTACAGGCCCAGAACGG - Intergenic
1105727145 13:23174956-23174978 CCATGGTCACAGGTGGAGGATGG + Intergenic
1106507532 13:30384310-30384332 TCATGGGGAAAGCTGGAGAAAGG + Intergenic
1106645192 13:31626417-31626439 TCATTGCTACAAGAGGAGAAAGG + Intergenic
1107081224 13:36376876-36376898 TAAAGGCTTCAGGTGGAGCAAGG - Intergenic
1107788789 13:43980116-43980138 TCATGGTGACAGAAGGAGAAAGG + Intergenic
1109790205 13:67236929-67236951 TCATGGCTAAAGGGTGAGAGTGG + Intergenic
1110784118 13:79503178-79503200 TCATGGTTAGAAGTGGAGACTGG + Intronic
1113094370 13:106648233-106648255 TCATGGCAACTGATGGAGAAGGG - Intergenic
1115306277 14:31937054-31937076 TTTTGGCTCCAGGTGGAGGATGG - Intergenic
1116902023 14:50370704-50370726 TCATGGCAAAAGGTGAAGGAGGG + Intronic
1117677298 14:58167554-58167576 TCTGGACTGCAGGTGGAGAATGG - Intronic
1118367631 14:65109228-65109250 CTGTGGCTACTGGTGGAGAATGG - Intergenic
1119347016 14:73934147-73934169 TCATGGCTACTGTTAGAGGATGG - Exonic
1120002515 14:79318572-79318594 ACATGACAACAGCTGGAGAATGG - Intronic
1123939852 15:25211545-25211567 TCATACCTCCAGGTGGGGAATGG - Intergenic
1124623320 15:31292659-31292681 TTCTGGCCACAGGTTGAGAAAGG - Intergenic
1126485880 15:49180424-49180446 TCAAAGCTATAGGTAGAGAAGGG - Intronic
1127593645 15:60454715-60454737 TCGGGGATACATGTGGAGAATGG + Intronic
1127986515 15:64076475-64076497 TCATGTCTATAGGTGCAGCAGGG - Intronic
1128336125 15:66786832-66786854 TCATCCCTGCAGGTGGAGGATGG - Intergenic
1128380125 15:67106174-67106196 TGCTGGCTGCCGGTGGAGAATGG - Intronic
1129671583 15:77610777-77610799 TCCTGGCTACTGGGAGAGAACGG - Intergenic
1130105196 15:80923552-80923574 TCATGGGTGCAGGTGGGGATGGG + Intronic
1130438552 15:83926950-83926972 TCATGGCTACAAATATAGAAAGG - Intronic
1130938896 15:88491531-88491553 GCATGGCAACACTTGGAGAATGG + Intergenic
1133832480 16:9336366-9336388 TCATTGTTGCTGGTGGAGAAAGG + Intergenic
1134589337 16:15439560-15439582 TCATGGGAACATGTGGAGAAAGG + Intronic
1135540263 16:23324668-23324690 GGATGGGTAGAGGTGGAGAAGGG - Intronic
1136077727 16:27828383-27828405 TGATGGCTCCAGGAGGAGGATGG - Intronic
1136710196 16:32230602-32230624 GCAGGGCAACAGGTGGGGAAAGG - Intergenic
1136757714 16:32698809-32698831 GCAGGGCAACAGGTGGGGAAAGG + Intergenic
1136810392 16:33171566-33171588 GCAGGGCAACAGGTGGGGAAAGG - Intergenic
1136816868 16:33281646-33281668 GCAGGGCAACAGGTGGGGAAAGG - Intronic
1138367613 16:56494256-56494278 TCATGGCTTCAGGTTGGGCACGG - Intronic
1138989059 16:62368215-62368237 TCATGGCTGAAGGTGAAGGAGGG - Intergenic
1140079538 16:71732260-71732282 TCATGACTACAGCTAAAGAATGG + Intronic
1203059864 16_KI270728v1_random:959158-959180 GCAGGGCAACAGGTGGGGAAAGG + Intergenic
1143199079 17:5099495-5099517 TCATGCCTTCAGGTGGAGGTGGG + Intergenic
1143374543 17:6459497-6459519 TCTGGGCTGCAGGTGGAGACTGG - Intronic
1146054395 17:29573941-29573963 CCCTGGCTCCAGGTGGGGAAGGG + Exonic
1146908463 17:36632832-36632854 TCAGACTTACAGGTGGAGAAGGG + Intergenic
1148838953 17:50482471-50482493 TGATGGCTGGAGGTGGAGGATGG + Intronic
1151404416 17:73877481-73877503 TCCTGGCTACAGCTGGAGCAAGG + Intergenic
1151444094 17:74152089-74152111 GCAGGGCTACAGATGGAGCAAGG - Intergenic
1152167461 17:78719472-78719494 TCATTACTGCAAGTGGAGAATGG + Intronic
1152474987 17:80512202-80512224 TCCTGGCTCTGGGTGGAGAATGG + Intergenic
1156342191 18:36219812-36219834 ACATGGCTCGAAGTGGAGAAGGG + Intronic
1156806853 18:41194540-41194562 TCATGGTGGCAGGTGAAGAAGGG - Intergenic
1156949112 18:42871697-42871719 TCATGGCCAAAGGTGTAGAAGGG + Intronic
1157892164 18:51428059-51428081 TCATGGCTGCAGGGGGATTAGGG + Intergenic
1160036230 18:75304174-75304196 TCATTTCTGCCGGTGGAGAATGG + Intergenic
1163090649 19:15017576-15017598 TCAAGGCTAGAGGTGGGGATGGG + Intronic
1163782273 19:19256818-19256840 CCATGGTTACAGCTGGAGGAGGG + Exonic
1163795065 19:19333164-19333186 TCATGGCCCCAAATGGAGAAGGG + Intronic
1165279929 19:34787070-34787092 TCCTGGCTGCAGTTTGAGAAAGG + Intergenic
1165756562 19:38296671-38296693 TGATGGCTTCAGGTGCAGAATGG - Intronic
1165856810 19:38883855-38883877 TGGTGGGGACAGGTGGAGAAGGG + Intronic
1165903082 19:39177855-39177877 GCAGGGCTCCAGGTGGAGCATGG + Intronic
1167687892 19:50968054-50968076 TGATTGCTGCAGGTGGGGAAAGG - Exonic
924995440 2:356417-356439 TCATGGCTTCATGGGGAGGAGGG + Intergenic
926660967 2:15465463-15465485 CCATTGCTAGAGGTAGAGAAAGG - Intronic
926855702 2:17253639-17253661 TGATGACTGCAGGTGAAGAAAGG + Intergenic
927497294 2:23559496-23559518 TCGTGGCTGCAGATGGAGAAGGG + Intronic
928976125 2:37088292-37088314 TCATGGCTGCAGATACAGAAAGG + Intronic
933157354 2:78991124-78991146 AGATGGCTACAGCTGGGGAACGG + Intergenic
933616418 2:84486485-84486507 ACCTGGATACAGTTGGAGAAAGG + Intergenic
934920087 2:98336026-98336048 TGGTGCCTACAGGTGAAGAAGGG - Intronic
935464951 2:103385200-103385222 TTATGGCTACTGGGGGACAAAGG + Intergenic
935543382 2:104375723-104375745 TCATGGCTAGAGCAGGAGAAAGG + Intergenic
937318010 2:120944195-120944217 TCATGGCAGCAGATGGGGAAGGG + Intronic
939093124 2:137801768-137801790 TCATGGGTATAGGTGGAGTCAGG - Intergenic
939350966 2:141036941-141036963 TCACTGCCACAGGAGGAGAAGGG + Intronic
942770395 2:179511128-179511150 TCATGGCAGCTGGTGGAGAGAGG + Intronic
943169006 2:184371683-184371705 TCATGGGTTCAGATGGGGAAGGG + Intergenic
944041180 2:195356959-195356981 TTATGGCTCCATATGGAGAAAGG + Intergenic
944448448 2:199816311-199816333 TCATGGCTACCAGTGAAAAAAGG + Intronic
946116385 2:217466231-217466253 TTAAGGCAGCAGGTGGAGAAAGG - Intronic
946717376 2:222566738-222566760 TCATGGATACAGGTAGATTAGGG + Intergenic
947163037 2:227233728-227233750 TCATGGCGGCAGGTGGTGATGGG + Intronic
947176405 2:227371822-227371844 TCATGGATATAGGAAGAGAAAGG - Intronic
947351004 2:229245051-229245073 ACATGTCTACTGGTGGAGATGGG - Intronic
948292578 2:236837017-236837039 TGATGGCTACAGATGCAGCATGG + Intergenic
1169394388 20:5216774-5216796 TCTTGGCTGCAGGTGCAGCAGGG - Intergenic
1169457821 20:5767886-5767908 AGCTGGCTACAGGAGGAGAAGGG + Intronic
1169704128 20:8483538-8483560 TTATGGCTTCAGGCAGAGAAGGG - Intronic
1171298415 20:24039020-24039042 GCATGGCTTCAGGTGGAACAGGG - Intergenic
1172026959 20:31955078-31955100 TCATGGATGCAGGTTGAGAGGGG + Intergenic
1172245324 20:33442145-33442167 TCCTGGCAACAAGTGGTGAAAGG - Intronic
1172435461 20:34926030-34926052 CCATGGGTACAGATGGAGCATGG + Intronic
1172801413 20:37578970-37578992 GCCTGGCTGCTGGTGGAGAAGGG - Intergenic
1173136288 20:40442122-40442144 TCATTGCTTCAGGTGGTCAAAGG + Intergenic
1173419059 20:42884474-42884496 TCTTGGCTACCTCTGGAGAACGG - Intronic
1174752430 20:53124746-53124768 CCATGTCTTCAGGTGGAAAATGG - Intronic
1174949190 20:55025871-55025893 TCATGTCTCCAGATGGAGAAAGG - Intergenic
1176929992 21:14797915-14797937 TGAAGGCTACAGAAGGAGAAAGG + Intergenic
1176961317 21:15162147-15162169 AAATGGATACAGGTGAAGAATGG + Intergenic
1177971795 21:27799143-27799165 TCATGCCCACAGGTGCATAAGGG + Intergenic
1178179130 21:30139743-30139765 GCATGGGTGCAGGTGCAGAATGG + Intergenic
1178637742 21:34319775-34319797 AGATGGCAACAGGTGGAGACGGG - Intergenic
1180232246 21:46434127-46434149 CCATGGCTACAGCTAGAGAAGGG - Intronic
1181007222 22:20019672-20019694 TCATGGCAGCACCTGGAGAATGG - Intronic
1181038889 22:20182659-20182681 TCAGAGCCACAGGTTGAGAAGGG - Intergenic
1182281147 22:29218388-29218410 CCATGGCAACCTGTGGAGAAGGG + Intronic
1182657066 22:31899185-31899207 CCATGGTTACAGCTGCAGAAAGG + Intronic
951270902 3:20622722-20622744 TCATGGCTACTTCTGGGGAATGG + Intergenic
952087243 3:29839117-29839139 TAATGGCTACAGATGAAGACTGG - Intronic
954806939 3:53226040-53226062 TCATGGCTACAGGTGGAGAAAGG - Intronic
959367635 3:105482914-105482936 TCATGGCTACCTGAGGAGAAGGG + Intronic
960673321 3:120172313-120172335 GCATGTCTACAGATGGAGAAGGG - Intronic
960874323 3:122282116-122282138 TCTCGGCTGCAGTTGGAGAAGGG - Exonic
961723733 3:128912333-128912355 TCAGGGCTGCAGGGAGAGAAAGG - Intronic
963605078 3:147406362-147406384 TCCTGGCAACAGGTGGAGTGGGG - Intronic
964259493 3:154819294-154819316 TCACGGAGACAGGGGGAGAAAGG + Intergenic
964847724 3:161062003-161062025 TCATGGCAACAAGTGCAGGATGG - Intronic
969454087 4:7291315-7291337 TCATGACTGCAGGTGCAGACGGG + Intronic
973159160 4:46993956-46993978 TCAAGGTTGGAGGTGGAGAAAGG + Exonic
973560109 4:52126920-52126942 TCATGGCACAAGGTGGGGAAAGG + Intergenic
976299767 4:83506782-83506804 TCATCGCTATAGAGGGAGAAAGG + Intronic
977521729 4:98093691-98093713 GCATGGCTACAGTTGGGGGATGG - Intronic
978284143 4:107054824-107054846 CCATGGCTTCAAGTAGAGAAAGG + Intronic
979247132 4:118520304-118520326 TGATGGCTACTGGTGGAGAAGGG - Intergenic
981680356 4:147390443-147390465 TCATGGGTAGATGTGGAGATTGG - Intergenic
985294703 4:188423336-188423358 TCATGGCTACAACAGGAGACTGG + Intergenic
985621781 5:959769-959791 CCAGGGCTGCAGGTGGGGAAGGG + Intergenic
985999773 5:3621184-3621206 TCATGGCTGTGGATGGAGAAAGG + Intergenic
986585523 5:9313009-9313031 TCCTGGCTACAGTAGGAGCACGG - Intronic
986613127 5:9589794-9589816 TCCTGGCTGGAGGTGGAGTAGGG + Intergenic
988582281 5:32478634-32478656 TATTGGCTATAGGTGGAAAACGG + Intergenic
989289604 5:39747974-39747996 ACAGGGCTAGAGGTGGAGGATGG - Intergenic
989745205 5:44820822-44820844 CCCTGGATACAGGAGGAGAAAGG + Intergenic
989983570 5:50669661-50669683 ACATAGCTAGAGGTGGAAAAGGG + Intronic
990984943 5:61632615-61632637 TCAAGGCCACACTTGGAGAATGG + Intergenic
993056989 5:82992564-82992586 TGATGGCTGCAGGTGGAGGTAGG - Intergenic
993847304 5:92959971-92959993 TCATGGCTAAATGTGGTGACTGG - Intergenic
995323178 5:110860169-110860191 TCATGGATAGAAATGGAGAAAGG - Intergenic
995710227 5:115027658-115027680 TTCTGACTTCAGGTGGAGAATGG - Intergenic
996188766 5:120513025-120513047 TCATGGCGTCAGGTGTATAAAGG + Intronic
996913292 5:128680026-128680048 TCATTGCTTCAGGTGGGGAAGGG - Intronic
998265852 5:140667257-140667279 TCATGGCTGAGGGTGGGGAAGGG - Intronic
998601433 5:143589304-143589326 GGATGGCTACTGGTGGAAAAGGG - Intergenic
1000175931 5:158754309-158754331 TGATTGCTACAGGTAGAGAATGG - Intronic
1000216059 5:159157614-159157636 TCATGGCTACAGGTAGAACTGGG - Intronic
1000827278 5:166060559-166060581 TCATGGCTGCAGTTGTAAAAGGG + Intergenic
1001471962 5:172020817-172020839 CCTTGGCCACAGCTGGAGAAAGG + Intergenic
1001837275 5:174843046-174843068 ACTTGGCTACATGAGGAGAATGG + Intergenic
1003020874 6:2508346-2508368 CAATGGCTACAGGTGGAGTGGGG + Intergenic
1008683386 6:53898251-53898273 TCTTGGCTACAGTTGGGAAAAGG + Intronic
1012728471 6:102847538-102847560 TAATGGCAACAGTTGTAGAAGGG - Intergenic
1013052447 6:106549392-106549414 TCATGGCCACAGGTGGAGCCAGG + Intronic
1013888374 6:114998630-114998652 TCCTGGGTAAAGGTAGAGAAAGG - Intergenic
1014283208 6:119465048-119465070 TGATGTCTACAGGAGGTGAAGGG - Intergenic
1015329234 6:131957821-131957843 GCCTGGTTAGAGGTGGAGAAGGG + Intergenic
1015718067 6:136212303-136212325 TCATGGCGGGAGGTGAAGAAGGG - Intergenic
1016861060 6:148719250-148719272 TAGAGGTTACAGGTGGAGAAGGG + Intergenic
1017522640 6:155215350-155215372 TCATTGTTAAAAGTGGAGAAAGG + Intronic
1018724045 6:166597030-166597052 TCATGGGAACAGATGGAGAAAGG + Intronic
1020747446 7:12094912-12094934 GAATGCCTACAGTTGGAGAAGGG - Intergenic
1022252492 7:28622367-28622389 TGGTGGCTACAGGTGGGTAAGGG - Intronic
1023708869 7:42970619-42970641 TCATGGCTATAGGACAAGAAGGG + Intergenic
1024660257 7:51486391-51486413 TCTTGGATACATGTGCAGAATGG + Intergenic
1024837012 7:53533118-53533140 CCTTGGCTACAGGGAGAGAATGG - Intergenic
1026560353 7:71443584-71443606 TCATGGCAGAAGGTGGAGGATGG - Intronic
1027494307 7:78868439-78868461 TAATGGTTACAGGTAGAGCATGG - Intronic
1029710094 7:102294756-102294778 ACCTGGCTACAGATGGAGAGAGG - Intronic
1030839514 7:114330905-114330927 TCATAGCTACAGGAGGAGTCTGG - Intronic
1032441087 7:131943616-131943638 TCAGAGCTGCAGGTGGAGGACGG + Intergenic
1032502985 7:132413888-132413910 TGATGGCTACATGTTGTGAATGG - Intronic
1039080068 8:33725375-33725397 TCCTGGCCACAGGAGGAGATAGG + Intergenic
1039173968 8:34782322-34782344 TCATGGCTGTAGGTGAAGCAGGG + Intergenic
1039626003 8:39053924-39053946 GCATGGCTACATTTGGAGATGGG + Intronic
1039710321 8:40049647-40049669 TCATGGCAAAAGCTGGAGCAAGG - Intergenic
1039721244 8:40167000-40167022 TCCTGGCAAAAGATGGAGAAAGG + Intergenic
1040072075 8:43196545-43196567 TCATGGGGAAAGGAGGAGAAGGG - Intronic
1044846699 8:96389036-96389058 CCATGGCCACAGCTGGAAAAAGG - Intergenic
1048857939 8:138699944-138699966 TCCTGAAAACAGGTGGAGAAAGG - Intronic
1050815630 9:9808322-9808344 TCAGGGCTTCAGGTGGAGGTGGG - Intronic
1051074925 9:13222256-13222278 TGCTGGCTGCAGATGGAGAACGG + Exonic
1051655749 9:19380077-19380099 TCCTGGCTTTAGGTGGAGAAGGG - Intronic
1052093873 9:24361679-24361701 ACATGGCCACTGCTGGAGAATGG - Intergenic
1055429210 9:76227027-76227049 TCATGGTTACTGGTCAAGAATGG - Intronic
1057317152 9:93976949-93976971 GCATGGCTACAAATGGATAATGG - Intergenic
1057412550 9:94829858-94829880 TCATGACTACAGGTGGCCCAAGG + Intronic
1057947390 9:99341427-99341449 TTCTGGCTAGAGGAGGAGAAGGG + Intergenic
1058252900 9:102724120-102724142 TCATTGCTGCAGGAGGAGACAGG - Intergenic
1060398791 9:123335307-123335329 TCATGCCTACAGTTAGAGGAAGG + Intergenic
1061865641 9:133490692-133490714 TCAAGGCTGCAGGAGGAGGATGG + Intergenic
1062197038 9:135280103-135280125 TCATGGCTACAGGTGGGCAGAGG - Intergenic
1185491548 X:521112-521134 TTCTGGGTACATGTGGAGAACGG - Intergenic
1186219182 X:7331401-7331423 TCATGGCTCTTGGTGGAAAAGGG - Intronic
1187392546 X:18895536-18895558 TCATGGCTCCTGCTGGGGAAGGG + Intronic
1187496042 X:19796664-19796686 TCTTGGCAGGAGGTGGAGAAAGG + Intronic
1189931707 X:46018974-46018996 TAATGGCCAAAGGTGGAGCAGGG - Intergenic
1190258934 X:48786176-48786198 TCCTGGCTGCAGGGAGAGAAGGG - Intergenic
1190667380 X:52707764-52707786 TCAGGGCTACAGGTAAAGGATGG - Intergenic
1190672038 X:52750644-52750666 TCAGGGCTACAGGTAAAGGATGG + Intergenic
1195831641 X:109065854-109065876 TCAGGGTTACATGTGCAGAATGG - Intergenic
1196112486 X:111962169-111962191 ACATGGGTACTGGTGGGGAATGG - Intronic
1197972619 X:132130974-132130996 TCATTGTTACAGGAGGAGATGGG - Intergenic
1198390324 X:136167669-136167691 GAAGGGCTACAGGTGGGGAAAGG - Intronic
1198760152 X:140023906-140023928 TCTGGGATACATGTGGAGAACGG + Intergenic
1200184561 X:154173878-154173900 GCAGGTCTACAGGAGGAGAAAGG - Intergenic
1200190212 X:154211016-154211038 GCAGGTCTACAGGAGGAGAAAGG - Intergenic
1200195965 X:154248818-154248840 GCAGGTCTACAGGAGGAGAAAGG - Intergenic
1200201620 X:154285936-154285958 GCAGGTCTACAGGAGGAGAAAGG - Intronic