ID: 954807605

View in Genome Browser
Species Human (GRCh38)
Location 3:53229541-53229563
Sequence ATTCAGAAGCCCAGAAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 0, 3: 44, 4: 355}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954807605_954807612 10 Left 954807605 3:53229541-53229563 CCATCCTTTCTGGGCTTCTGAAT 0: 1
1: 0
2: 0
3: 44
4: 355
Right 954807612 3:53229574-53229596 CCACCTTCTTCTGCAGAGACCGG 0: 1
1: 0
2: 2
3: 20
4: 220
954807605_954807615 30 Left 954807605 3:53229541-53229563 CCATCCTTTCTGGGCTTCTGAAT 0: 1
1: 0
2: 0
3: 44
4: 355
Right 954807615 3:53229594-53229616 CGGTCCTCCCAACCCCTCCCTGG 0: 1
1: 0
2: 0
3: 26
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954807605 Original CRISPR ATTCAGAAGCCCAGAAAGGA TGG (reversed) Intronic
900558857 1:3293795-3293817 ATGGAGAAGCCGACAAAGGATGG - Intronic
902038578 1:13475637-13475659 GCACAGAAGCCCAGGAAGGATGG - Exonic
902562693 1:17287653-17287675 TTCCAGCAGCCCAGGAAGGAGGG + Intergenic
904313934 1:29647738-29647760 ATACAGATGTCCAGAAAGCAAGG + Intergenic
905039532 1:34944096-34944118 AATCGGAAGCCCAAAAAAGAGGG + Intergenic
905299476 1:36976706-36976728 ACTCAGAGCCCCAGGAAGGATGG - Intronic
905305128 1:37012538-37012560 AGTCAGAAGGCCAGAGTGGAAGG + Intronic
905722449 1:40217137-40217159 ATTCAACAGCCCAGAAAAAAAGG - Intronic
906155918 1:43613825-43613847 TTTCAGGAGCACAGAGAGGAGGG + Intronic
906826910 1:48992052-48992074 ATTCAAATGCCCAGACAGCAAGG - Intronic
907213907 1:52845951-52845973 ATTAAAAAGCACAGAAAGGCCGG - Intronic
907275654 1:53315293-53315315 GTGCAGCAGCCCAGTAAGGATGG + Intronic
908089286 1:60669545-60669567 TTCTAGAAGCCTAGAAAGGATGG + Intergenic
908247067 1:62235864-62235886 ATTAAAAATCTCAGAAAGGATGG + Intergenic
909357095 1:74722193-74722215 AAACGGAGGCCCAGAAAGGAGGG + Intronic
910336459 1:86137585-86137607 CTTCAGAAGCAAATAAAGGAAGG - Intronic
910501808 1:87900822-87900844 CTTCACAAGCCCAGGAAGTAGGG + Intergenic
910837471 1:91530263-91530285 ATGCAAAAGCCCAGAAGAGAAGG - Intergenic
912414675 1:109499828-109499850 ACTCTGCAGCCCAGGAAGGAGGG - Intronic
916009595 1:160692687-160692709 ATTGAGAAGTCAAGAAAGGAAGG + Intronic
919637459 1:200016813-200016835 ATTCAGAAGCAAAGAGATGATGG + Intergenic
919788859 1:201277221-201277243 TTACAGAGGCCCAGAAAGGAGGG - Intergenic
920565896 1:206972859-206972881 ACTTAGAAGCTCACAAAGGAAGG + Intergenic
920861757 1:209714597-209714619 ATTAAGAAGCCCTGACACGAAGG - Intronic
921167883 1:212520012-212520034 TTACAGAAGCTCAGAAAGGATGG + Intergenic
922343294 1:224674755-224674777 ACCGAGAAGTCCAGAAAGGAGGG - Intronic
922458916 1:225799756-225799778 ATTCAGAAGGCCAGAGCTGAAGG - Intergenic
923275278 1:232389923-232389945 CTTCTGAAGGCCAGAAAGGTGGG + Intergenic
923638285 1:235723493-235723515 ACCCAGAAGCCCAGGGAGGAAGG + Intronic
1062901402 10:1149439-1149461 ATGCAGAAGCCCAGGAAGGGCGG - Intergenic
1063349119 10:5338142-5338164 TTTCAGAAACAAAGAAAGGAGGG - Intergenic
1063531054 10:6831713-6831735 ATTGATAAGTCAAGAAAGGAAGG - Intergenic
1065259978 10:23914123-23914145 ATACAGAAGCCAAGATTGGAAGG + Intronic
1066048605 10:31615964-31615986 TTTCAGAAGCCCTGGATGGAAGG + Intergenic
1066977418 10:42381851-42381873 ATTAAGAAGCACAGACAGCAAGG - Intergenic
1068423254 10:56822712-56822734 AGTCAGAAACCCTGAACGGAGGG + Intergenic
1069413900 10:68181016-68181038 ATTCATTAGCCTAGAGAGGATGG + Intronic
1070030591 10:72673219-72673241 AATCAGAATTCCAGAAAGGTAGG + Intergenic
1072678509 10:97487652-97487674 ATTCAGAAGCCCTAAAAGATTGG + Intronic
1072680262 10:97500645-97500667 AGTCTGATGCCAAGAAAGGAAGG - Intronic
1073520090 10:104120735-104120757 ATTAAGAAGCACATAAAGTATGG + Intergenic
1073623474 10:105072991-105073013 ATTCTGAGGCCCAGAGAGGTTGG + Intronic
1073903938 10:108255031-108255053 CTTCAGAATCTCAGAAAGGAAGG - Intergenic
1074212933 10:111354314-111354336 AATCAGAACCCCTGAGAGGAGGG + Intergenic
1074851479 10:117442824-117442846 ATCCAGAAGCACAGAAGGGCTGG - Intergenic
1075243760 10:120801771-120801793 AGGCAGAAGCCCAGAAATGAGGG + Intergenic
1076136688 10:128050034-128050056 TCTCAGAAGCCATGAAAGGATGG - Intronic
1076405172 10:130206952-130206974 CTGCAGAAGACCAGAGAGGAAGG - Intergenic
1078377992 11:10812276-10812298 ATTCATAAGCACAGAGAGGATGG - Intronic
1079571172 11:21945056-21945078 ATTGAGAAGCCTAGAAAGCCTGG + Intergenic
1080081900 11:28230597-28230619 ACTCAGAAGCCCAAACATGAAGG - Intronic
1083150439 11:60788685-60788707 CTTCTGAAGCCCAGGAAAGAGGG + Intronic
1084128547 11:67117741-67117763 ATTCTAAATCCCACAAAGGACGG - Intergenic
1084445937 11:69203863-69203885 ACACAGAGGCCCAGAAAGAAGGG + Intergenic
1084688258 11:70710022-70710044 ATTCAGAGGCCAGGAAAGGGTGG + Intronic
1084728122 11:70955177-70955199 ATCCAGAAGCAAAGAAAGGGTGG - Intronic
1085639020 11:78179610-78179632 AGTCTGCAGACCAGAAAGGAAGG - Intronic
1086451616 11:86922713-86922735 ATACAGCAGCCTAGACAGGAAGG + Intronic
1086557445 11:88127769-88127791 ATCCAGAACCCCAGCAAGGTAGG + Intronic
1086978742 11:93169383-93169405 ATACTGCAACCCAGAAAGGAGGG + Intronic
1087512550 11:99115827-99115849 AGTGAGAAGCAAAGAAAGGAAGG + Intronic
1088091859 11:106050444-106050466 GGTCAGAAATCCAGAAAGGAGGG + Intergenic
1088357876 11:108961984-108962006 ATTCTGAAGCCCAGAGATCACGG - Intergenic
1088983005 11:114880797-114880819 TTTCAACAGCCAAGAAAGGATGG + Intergenic
1089355608 11:117850197-117850219 ATTCAGAAGACCACCAAGCAAGG - Intronic
1089446588 11:118557733-118557755 AGCCAGAAGCACAGAAAGGTAGG - Exonic
1089810466 11:121127473-121127495 AATCAGTAGTCTAGAAAGGATGG + Intronic
1090918883 11:131191087-131191109 ATTCAGAAGCCAGGAAAACATGG + Intergenic
1093168311 12:15830719-15830741 ATTCAGAGGCCAAGGAATGAGGG - Intronic
1093532642 12:20185844-20185866 ATTCAGAAGAACAGTAAGCAAGG - Intergenic
1093854828 12:24088870-24088892 ATTCAGAAGGCCAGTGAAGAAGG - Intergenic
1097583868 12:61491957-61491979 ATTTAGAAGAACAGAAGGGAAGG + Intergenic
1098878612 12:75892907-75892929 ATTGAGAAACCAGGAAAGGAAGG - Intergenic
1101394193 12:104329779-104329801 AGGCAGAAAACCAGAAAGGATGG - Intronic
1102098179 12:110257119-110257141 AGTCAGAAGCTCAGCAGGGAAGG - Intergenic
1102360641 12:112284769-112284791 AATCAGAATCCCAAGAAGGATGG - Intronic
1102803402 12:115757718-115757740 ATTTCGAAGCCCAGAATGTATGG + Intergenic
1103621334 12:122189223-122189245 CTTCAGCAGCCCAGCAAGGATGG + Intronic
1103903012 12:124313134-124313156 CATCAGAAGCCCAGCAAGGGTGG + Intronic
1104389686 12:128381289-128381311 ATACAGAATCCCACAAATGATGG + Intronic
1104478166 12:129087580-129087602 AGGCAGAGGCCCAGGAAGGAAGG + Intronic
1105285117 13:18997030-18997052 GGTCAGAAGGCCAGAAAGGCTGG + Intergenic
1106071229 13:26413039-26413061 AGTCAGAGGGCCAGAATGGATGG + Intergenic
1106102005 13:26701893-26701915 ATACATAAGCCCATGAAGGAGGG - Intergenic
1106239414 13:27898535-27898557 CATCAGAATCCCAGAAAGAAAGG - Intergenic
1106281392 13:28275759-28275781 AGTCAGGAGCCCAGAATGGCAGG - Intronic
1106286219 13:28320217-28320239 ATACAGACGAACAGAAAGGAGGG + Intronic
1107632234 13:42354365-42354387 GTTCAGAAGCACAGATAGAAAGG - Intergenic
1107760728 13:43675707-43675729 AGTCAGCAGCACTGAAAGGAGGG + Intronic
1108127382 13:47259053-47259075 ATTTTGAATCCCAGAAACGAAGG - Intergenic
1109890344 13:68603424-68603446 ATTCAGAGCCCTAGAAAGGGTGG - Intergenic
1110121868 13:71892309-71892331 ACTCAGAAGCCCAAAAATGGTGG - Intergenic
1110180183 13:72607390-72607412 AATCCGAAGCAGAGAAAGGATGG + Intergenic
1110715194 13:78694639-78694661 CCTCCCAAGCCCAGAAAGGAAGG - Intergenic
1110716713 13:78713789-78713811 ATTAATATTCCCAGAAAGGAAGG - Intergenic
1111108173 13:83673208-83673230 ATTCCTGACCCCAGAAAGGAAGG - Intergenic
1112051924 13:95651112-95651134 ATTCAGATGGCCATAAAAGAGGG + Intergenic
1113190284 13:107737794-107737816 ATACAGAACCCCAGACAGCAGGG - Intronic
1114753130 14:25228236-25228258 AATCAGCAGCCCCGAATGGAGGG - Intergenic
1115724694 14:36200330-36200352 ATTCAGAAACTGAGATAGGAGGG + Intergenic
1116132594 14:40876076-40876098 ATTCAGAAGAGCAAATAGGAGGG + Intergenic
1116799213 14:49425719-49425741 ATTCAGGTGCCCATAAAGGAAGG + Intergenic
1117055734 14:51910469-51910491 GTTCAAAAGCCCAGGATGGAAGG + Intronic
1119432557 14:74578042-74578064 ACACAGAAGCCCAGAGGGGAGGG + Intronic
1119920460 14:78441469-78441491 AATCGGAAGCACAGAAAGCAAGG - Intronic
1120361599 14:83511145-83511167 ATTTGAAAGCCAAGAAAGGAAGG - Intergenic
1120674007 14:87397756-87397778 AGTCAGATGCACAGAAAGGGAGG - Intergenic
1120710309 14:87786724-87786746 ATTCATAAGCCCAGCAAACAAGG - Intergenic
1120841031 14:89084944-89084966 TTTCAGAAGCACAGAAACTAAGG - Intergenic
1120993754 14:90399307-90399329 ATTCAGAAGCCAGGAAAAAATGG - Intronic
1121191902 14:92038352-92038374 AGTCAGAAGCACAGAAGGGCTGG - Intronic
1121838396 14:97112511-97112533 CTTCAGGGGCCCAGATAGGAAGG + Intergenic
1122246503 14:100406940-100406962 ATTCTGAATCCCAAGAAGGAAGG - Intronic
1122362500 14:101175715-101175737 AGGCAGAAGCCCTTAAAGGAGGG + Intergenic
1124019095 15:25903478-25903500 ATTGCAAAGCCCAGGAAGGAGGG + Intergenic
1124347430 15:28932018-28932040 ATGCAGCAGCACAGAAAGGAGGG - Intronic
1125066977 15:35499285-35499307 TTTCAGAACTTCAGAAAGGAGGG + Intronic
1126887024 15:53162146-53162168 AATCAGAAGCCCAGGAAGAATGG + Intergenic
1127762021 15:62148653-62148675 AGTCAGAAATCCAGAAAGAAAGG + Intergenic
1128073012 15:64808890-64808912 CTCCAGAAGGCCAGACAGGAAGG + Intergenic
1129451364 15:75652945-75652967 ATTCAGATGTCCAGACAGGCTGG - Intronic
1129901461 15:79154295-79154317 GTCCAGAAGCCCAGAGAGGAGGG + Intergenic
1130211371 15:81926009-81926031 TTCCAGAGGGCCAGAAAGGATGG - Intergenic
1130407156 15:83612378-83612400 ATTCAGCAACCCAGAGAGGGAGG - Intronic
1130849634 15:87780460-87780482 ATTCAGAAGCTCTGAAATGAGGG - Intergenic
1131666760 15:94579317-94579339 ATTCTGAAGCTCAGCCAGGATGG + Intergenic
1131729354 15:95262825-95262847 ATTAAGAAACCCAGAAGGAACGG - Intergenic
1131748523 15:95478303-95478325 ATGCTGGAGCCCAAAAAGGAGGG - Intergenic
1132413011 15:101599464-101599486 TATCAGAATCCCAGAAAGAAAGG - Intergenic
1133880406 16:9776554-9776576 ATTCTGAAACCCAGAAATCAAGG + Intronic
1134390675 16:13817077-13817099 ATACAGCAGCACAGAAAGGCTGG - Intergenic
1136263548 16:29099573-29099595 ATTCTGGAGCCCAGACTGGAAGG - Intergenic
1136935946 16:34464948-34464970 TACCAGAACCCCAGAAAGGAAGG - Intergenic
1136963874 16:34883622-34883644 TACCAGAACCCCAGAAAGGAAGG + Intergenic
1136997030 16:35197729-35197751 CTTCTGAAGGCCAGAAAAGACGG + Intergenic
1137391016 16:48081538-48081560 CTACAGATGCCCAGGAAGGAAGG - Intergenic
1137660850 16:50204791-50204813 ATAAATAATCCCAGAAAGGATGG + Intronic
1139828169 16:69774072-69774094 ATTCAGATGTCTAGAAAGGATGG + Intronic
1140449362 16:75058046-75058068 ATTTAGAGGACCAGAAAGGATGG - Intronic
1140588033 16:76317863-76317885 ATTCAGAAGCACACAAAAGTAGG - Intronic
1140649678 16:77073217-77073239 AAGCAGAATACCAGAAAGGAAGG + Intergenic
1141601640 16:85130324-85130346 ATTCTGCTGCCAAGAAAGGAGGG + Intergenic
1142314718 16:89336388-89336410 ATTCAAAGACCCAGGAAGGAAGG + Intronic
1142782253 17:2190353-2190375 ACTCAGAAGGCTAGAAGGGATGG + Intronic
1145016584 17:19402739-19402761 ACACAGCAGGCCAGAAAGGAGGG + Intergenic
1145288996 17:21528362-21528384 AGCCAGAAGCCCAGAAATGGGGG - Exonic
1147530215 17:41269257-41269279 ATTAAGAAGCAAAGAAAGGAGGG + Intergenic
1148904414 17:50902927-50902949 ATGCAGCTGCCCAGAAAGAAAGG - Intergenic
1149028525 17:52057867-52057889 AGTCAGAAGTGCACAAAGGAAGG - Intronic
1149590170 17:57823191-57823213 ATTCTGAAGGCCCGAAAGGCAGG + Intergenic
1150833929 17:68547902-68547924 ATTCAGGAGGCTAGTAAGGAAGG - Intronic
1151641054 17:75394202-75394224 TCTCAGAAGACCAGAAAGGATGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152679524 17:81659022-81659044 AATCACTAGTCCAGAAAGGACGG + Intronic
1156402756 18:36755766-36755788 ATTCAGATGCCCACAATGGGTGG - Intronic
1157161425 18:45317715-45317737 CTCCAGAAACCCAAAAAGGATGG - Intronic
1157346966 18:46847032-46847054 TTTCACAAGTCCAGAAAGGTAGG + Intronic
1158150044 18:54357758-54357780 ATTCCCAGCCCCAGAAAGGAGGG + Intronic
1160428715 18:78796694-78796716 ACTCATAAGCCCATAAAGGGAGG + Intergenic
1160791747 19:926554-926576 ATTCGGGAGCCCAGAGAGGAGGG + Intronic
1161165943 19:2787498-2787520 CTTCAGGGGCTCAGAAAGGATGG - Intronic
1162693370 19:12451897-12451919 ATTCAGAAGGCTAGAACTGAAGG + Intronic
1162824799 19:13244813-13244835 TGTCAGGAGCCCAGAAAGAATGG - Intronic
1163096618 19:15062621-15062643 ATGCAGAGGCCCAGAAAAGTGGG + Intergenic
1164153881 19:22576842-22576864 ATTGATAAGTCAAGAAAGGAAGG + Intergenic
1164530475 19:29044432-29044454 ATTAACCAGCGCAGAAAGGAAGG - Intergenic
1164560336 19:29287741-29287763 ATTCTGAATCCCAGAAGTGATGG + Intergenic
1164569881 19:29366162-29366184 ACTCTGAAGCCAAGAGAGGAGGG - Intergenic
1164920846 19:32087551-32087573 ATTTGGAAGCTTAGAAAGGAGGG - Intergenic
1166838663 19:45682917-45682939 AAGCTGGAGCCCAGAAAGGAGGG + Exonic
1167723075 19:51192255-51192277 ATTCAGCAGCTCAGGAAGGAGGG + Intergenic
925551562 2:5081404-5081426 ATTCAGAATGGAAGAAAGGAGGG - Intergenic
925957000 2:8976533-8976555 ACACAGACGCACAGAAAGGATGG + Intronic
926170290 2:10548837-10548859 AGTCAGAGTCCGAGAAAGGAAGG - Intergenic
926602882 2:14865095-14865117 GTTAAGAAGCCCAGAACAGAAGG - Intergenic
926751589 2:16202644-16202666 AATCTGAAGCCCAGAGAGGCAGG - Intergenic
926794587 2:16608409-16608431 ACACGGAAGCCCAGAAACGAGGG + Intronic
927038270 2:19203252-19203274 CCTCAGGAGCACAGAAAGGAGGG + Intergenic
928312159 2:30220112-30220134 ATTCAGATTCCCAGAGAGGCAGG - Intergenic
928405450 2:31011048-31011070 AGACAGAAGCACAGGAAGGAGGG + Intronic
929078730 2:38100643-38100665 ATTCAGAGCCCTAGAAAGGAAGG - Intronic
930594569 2:53371113-53371135 TTTGAGAAGACTAGAAAGGAAGG - Intergenic
931430073 2:62202319-62202341 TTTCAGAGGCAGAGAAAGGAAGG + Intronic
931527575 2:63173672-63173694 TTTCCAAAGCCCAGAAATGATGG + Intronic
932953205 2:76317933-76317955 TTTTAGACTCCCAGAAAGGACGG + Intergenic
934468341 2:94287433-94287455 GATCAGAACCCCAGAAAGGCAGG - Intergenic
935554992 2:104499618-104499640 ATTCAGAAGCCAATAAAATAGGG + Intergenic
938150576 2:128879258-128879280 TTTCAGCAGCTCAGAAAGGAGGG - Intergenic
938730399 2:134142678-134142700 AATCAGAAGCTGAGAAGGGAAGG + Intronic
939230458 2:139418406-139418428 AATCAGAATCCCAGAAAGAGAGG - Intergenic
939768499 2:146284683-146284705 ATTCAGAAATCTGGAAAGGATGG - Intergenic
939857081 2:147371520-147371542 ATTTGGAATCCCAGAAAGGAAGG + Intergenic
941967774 2:171316624-171316646 ATTCAGGATCCCAAAAAGCAAGG - Intergenic
942831581 2:180242906-180242928 ATTCAGAATCCCCGAAACTAAGG - Intergenic
943946029 2:194065543-194065565 ATTCATATGCCCAGAATAGATGG + Intergenic
945629282 2:212252319-212252341 ATTAAGAAGAGCAGAAAGGTAGG + Intronic
945897581 2:215501913-215501935 ATTCAGAAAAGCAGATAGGATGG + Intergenic
947614301 2:231545276-231545298 ATACGTAAGCCCAGAAAGCATGG - Intergenic
947787690 2:232838592-232838614 AATCAGAAGATCAGAAGGGAAGG - Intronic
948301357 2:236909570-236909592 AATCAGAAGCCGAGACTGGAGGG - Intergenic
1169000318 20:2163578-2163600 GTTCAGAAGCCCTGAGTGGAGGG + Intronic
1169068850 20:2709525-2709547 AGGCAGAAGCCAAGGAAGGAGGG - Intronic
1169222877 20:3836668-3836690 CTTGAGAAGCCCAGAAATGCTGG - Intergenic
1170398408 20:15953142-15953164 AGGCAGAAGCCAAGAAAGGTTGG + Intronic
1172928721 20:38565916-38565938 CTTCAGCAGCCTAGAAAAGATGG + Intronic
1173420161 20:42894093-42894115 ATTCTGAATCCGAGAAAGAAGGG + Intronic
1173622706 20:44448889-44448911 AAACTGAAGCTCAGAAAGGAGGG - Intergenic
1173854029 20:46238205-46238227 ATTAAAAAGTCCAGAAAGGTGGG - Intronic
1174004428 20:47399149-47399171 ATTCAGAAACTCTGTAAGGATGG - Intergenic
1174136119 20:48381293-48381315 ATTAAGGACCCCAGAATGGATGG - Intergenic
1174908417 20:54577768-54577790 GTTCAGAAATCCAGGAAGGAGGG + Intronic
1176923384 21:14717105-14717127 ATTTGGAACTCCAGAAAGGAAGG + Intergenic
1177588908 21:23136032-23136054 AGTCAGAGGCCCTGAACGGAGGG - Intergenic
1179658843 21:42862101-42862123 CTGCAGAAGCCCTGAAAGGGTGG - Intronic
1180595712 22:16971874-16971896 ATGCAGAGGCCCAGGAAGGAAGG - Intronic
1181011960 22:20046388-20046410 TTTCGGAGGCCAAGAAAGGAGGG - Intronic
1181123732 22:20689919-20689941 AGGCAGGATCCCAGAAAGGAAGG - Intergenic
1182182200 22:28362081-28362103 ATTCTGAAGCCCACAAATCATGG + Intronic
1182742792 22:32580905-32580927 ATTCAGAACCCCAGGCAGGCGGG + Intronic
1182988380 22:34742674-34742696 ATACACAAGCACACAAAGGAGGG + Intergenic
1183149494 22:36027060-36027082 AATCAGAAGTCCAGAGAAGATGG - Intronic
1183324980 22:37186377-37186399 ATCCAGAAGCCCTGCAGGGAGGG + Intronic
1184098502 22:42329439-42329461 ATTCAGGAGCAAAGTAAGGAGGG + Intronic
1184277603 22:43419079-43419101 CTCCAGCAGCCCAGGAAGGAAGG + Intronic
949630940 3:5925665-5925687 ATTCAGAGGTCCAGAAAGATTGG + Intergenic
949959597 3:9301150-9301172 ATGCAGAATCCCAGAAAGTCAGG - Intronic
950028206 3:9834890-9834912 ATCCTGAAGCCAAGAAAGGTGGG + Exonic
950545248 3:13634435-13634457 ATGGAGATGCCCAGAAGGGAAGG - Intronic
951416947 3:22435792-22435814 ATTCACATGCCAAGAATGGAAGG + Intergenic
952217518 3:31292518-31292540 ATTCTGGAGCCCAGAATGAATGG + Intergenic
952625463 3:35397429-35397451 ATTCATGAGCCCAAAAATGAGGG + Intergenic
952703355 3:36349653-36349675 ATTCAAAAGCCTTGCAAGGAAGG - Intergenic
953108765 3:39911863-39911885 CTTCAGAAGCTGAGTAAGGAGGG - Intronic
953190038 3:40677153-40677175 AATCTGAAGCCCAGATAGGCTGG - Intergenic
953262467 3:41353058-41353080 TTTCCCAAGTCCAGAAAGGAAGG - Intronic
953833284 3:46321431-46321453 AACCAGAAGCCTTGAAAGGATGG + Intergenic
954153155 3:48669270-48669292 ACTCAGAGGCCAAGACAGGAGGG - Intergenic
954756328 3:52842321-52842343 ACTCAGAAGACCAGAAAATAAGG + Intronic
954807605 3:53229541-53229563 ATTCAGAAGCCCAGAAAGGATGG - Intronic
955931350 3:64060417-64060439 ATTAAAAATCCCAGAAGGGAAGG - Intergenic
955947383 3:64208430-64208452 AGTCAGAACGCCAGAAAGGAAGG + Intronic
957708083 3:83815942-83815964 ATTAAGAAGACAAGACAGGATGG + Intergenic
958845587 3:99260982-99261004 ATTCACAAGTCCAGAAATCAAGG - Intergenic
959100436 3:102003404-102003426 ATTCAAAGGCCCAGAAAGATTGG - Intergenic
959414927 3:106072409-106072431 ATACAGCAGCCCAAAAGGGAGGG - Intergenic
959417317 3:106091227-106091249 AATCAGAAGAGCAGACAGGAAGG + Intergenic
960084465 3:113575885-113575907 GTTCAGATGCCCAGAAATGCAGG + Intronic
960389773 3:117063442-117063464 AAACAGAAGCCCAGAGAGGAGGG - Intronic
960477828 3:118152021-118152043 ATTCAGAAGACAAGAAAAAATGG + Intergenic
960567067 3:119145497-119145519 AATCAGAGTTCCAGAAAGGAAGG - Intronic
961001522 3:123377329-123377351 ATGCAGAAGCCCTGTTAGGATGG - Intronic
961459550 3:127041625-127041647 GTTCAGAATCCCAGACAGCACGG + Intergenic
962377473 3:134870478-134870500 ATTCAGAAGCCCACTTAGAAAGG + Intronic
962475437 3:135751260-135751282 ATTCAGAAGCCCGGAAAAGTGGG + Intergenic
963206668 3:142643197-142643219 AGACTGGAGCCCAGAAAGGAAGG + Intronic
963814204 3:149812374-149812396 ATTGAGACAACCAGAAAGGAAGG + Intronic
964794458 3:160482016-160482038 ATTCAGAACAGCAGGAAGGAAGG + Intronic
966213297 3:177475278-177475300 AAACAGAAGCCCAGAAAACATGG - Intergenic
967782800 3:193458072-193458094 AATCAGTAACCCAGAAAAGATGG + Intronic
967802499 3:193678774-193678796 ATACACAAGCACACAAAGGAAGG - Intronic
968378510 4:66457-66479 ATTCAAAAGCACAGAAAAGTAGG - Intronic
968582573 4:1401897-1401919 GTTCAGAGCCCCAGAAAGGGTGG - Intergenic
969241706 4:5902998-5903020 ATGCAGAGGCCCAGGGAGGAAGG - Intronic
970137747 4:12944415-12944437 ATTCAGCAGGGCAGAAAGGAAGG - Intergenic
972689110 4:41379388-41379410 ATTCAGGAGAGCAAAAAGGAAGG + Intronic
972957414 4:44409533-44409555 ATTCAGAAGCTTAGAAATAATGG + Intronic
973862491 4:55079135-55079157 ATTCAGAATACCACAAAGAAAGG - Exonic
974468781 4:62292397-62292419 ATTCAGACACCCAGAAAGCAAGG + Intergenic
974861997 4:67533628-67533650 ATTCAGCAACCCAGAGAGAATGG + Intronic
975489363 4:74971687-74971709 ACTCAGAATCTCAGAGAGGAAGG - Intronic
977064861 4:92302733-92302755 ATTCAGAAGGCTAGAGAGAAGGG + Intronic
977818037 4:101439094-101439116 ATTCATAAGCACAGATAGCACGG + Intronic
980165334 4:129219791-129219813 ATAAAGCAGCCCAAAAAGGAAGG + Intergenic
980835787 4:138190236-138190258 ATTCAGAAAAAAAGAAAGGAGGG + Intronic
980900369 4:138899620-138899642 ATTCACAAGGCGAGAAGGGATGG - Intergenic
981347539 4:143694205-143694227 GTGCTGAAGCCCAGCAAGGAGGG + Intronic
982525346 4:156470939-156470961 ATTCAGAAGCAGAAGAAGGAAGG + Intergenic
982588111 4:157268838-157268860 ATTTAAAAACCAAGAAAGGAAGG + Intronic
984617284 4:181913200-181913222 ACGCAGAAGCCGAGACAGGAAGG + Intergenic
985149040 4:186927684-186927706 ATTCAGGAGGTCAGAGAGGAGGG + Intergenic
985981983 5:3477665-3477687 AAACAGAAGCTGAGAAAGGATGG + Intergenic
986739557 5:10694184-10694206 ATTCAGAACCACGCAAAGGAGGG + Intronic
986805743 5:11307215-11307237 ATTCAGGAGCAGAGAAAGAAGGG - Intronic
986884646 5:12218047-12218069 ATTCAGTAACCCAGAGAGAAGGG - Intergenic
987978177 5:25043414-25043436 ATTCTGCAGCCCAGAAATCAAGG + Intergenic
989401607 5:41013730-41013752 ATTCAGGAGCAAAGGAAGGAAGG + Intronic
993834613 5:92802501-92802523 ATTGACAAGCCCAGAAAAGCAGG - Intergenic
995359390 5:111277570-111277592 TTCCAGCAGCCCTGAAAGGATGG + Intronic
996488848 5:124068404-124068426 ATTAAGAAGCCCAGATACCATGG - Intergenic
996519303 5:124409314-124409336 ATTGAGAGGCCCAGAAATCAAGG + Intergenic
997113581 5:131101718-131101740 AGTCAGAAGGCCATAAAGGAGGG - Intergenic
997371771 5:133366043-133366065 ATCCAGAAGCCCAGGCAGGTGGG - Intronic
997669282 5:135657058-135657080 ATTCAGATGCCCATTGAGGAGGG - Intergenic
997758149 5:136419834-136419856 ACTCAGAGGCCCAGATAGGAAGG - Intergenic
998666814 5:144307062-144307084 ATGGAGAAGGCCAGAAAGGTGGG - Intronic
998761732 5:145439748-145439770 GTACAGAAGGCCAGAAAGCAGGG - Intergenic
1001104759 5:168843707-168843729 TTAGAGAAGCCCAGAGAGGAAGG - Intronic
1001598180 5:172911700-172911722 GTTCAGAAACACAGAAAGGAAGG - Intronic
1001953140 5:175830072-175830094 TTTCAGAACCCCAGAGAGCACGG - Intronic
1003049157 6:2765019-2765041 ATTCAACAGCCCAGCACGGAAGG + Intergenic
1005299327 6:24455369-24455391 GCACAGAAGCCCTGAAAGGAAGG + Intronic
1005912687 6:30325293-30325315 AAACAGAAAGCCAGAAAGGAGGG + Intergenic
1006548862 6:34803637-34803659 ATTCAGAAGCTGTGAAAGTAAGG - Intronic
1006779904 6:36625385-36625407 ATTAAGAAGCCCAGAAAATGTGG + Intergenic
1007599371 6:43072255-43072277 GGTCAGAAGCCCAGAGGGGAAGG + Exonic
1007662189 6:43493647-43493669 AGGCAGAACCCCGGAAAGGATGG + Intronic
1007722972 6:43896599-43896621 ACTCAGAGACCCAGAAATGATGG - Intergenic
1008546151 6:52585469-52585491 CTTTAGAAGCAAAGAAAGGAAGG + Intergenic
1011055421 6:83198705-83198727 ATTCAGTAGGTCAGAAATGAGGG - Exonic
1013003529 6:106048697-106048719 ATACTGAAGGCCAGAAAGGTAGG + Intergenic
1013110467 6:107060831-107060853 ATCCAGAAGCCCAGAAATAGTGG + Intergenic
1013333483 6:109130558-109130580 ATTCAGAAGAACCGAAAGCAGGG - Intronic
1013353909 6:109330964-109330986 ATTCAGAGAGACAGAAAGGATGG + Intergenic
1013990620 6:116251045-116251067 ATGCAGAAGCTGAGAAATGAGGG + Exonic
1014426116 6:121308584-121308606 AGTCAGAAGGCCAGAAAATATGG - Intronic
1014681586 6:124437494-124437516 AATCAGAAGGTGAGAAAGGAAGG - Intronic
1015887543 6:137933775-137933797 ATTGAGAAGCCAAAATAGGAAGG - Intergenic
1016857402 6:148684667-148684689 TGCCAGAAGCCCAGACAGGATGG + Intergenic
1018359371 6:163051479-163051501 AATCAAAAGCCCAGAAATTAAGG - Intronic
1018446724 6:163865145-163865167 ATTCTGTAGCCCTGAAAGTATGG + Intergenic
1018468733 6:164078204-164078226 AATCAGAATCCCAAAGAGGAAGG - Intergenic
1018540952 6:164878557-164878579 ATTCATAAGCCCAGGAACGAAGG + Intergenic
1020381276 7:7549653-7549675 ATTCAGAATCCAAGGATGGAAGG + Intergenic
1022326653 7:29338263-29338285 AATCTGAAGCCCACAGAGGATGG - Intronic
1022475124 7:30705011-30705033 ATGCAGCAGCCCAGGCAGGAAGG + Intronic
1022495675 7:30851689-30851711 AAACAGAAGCCCAGAGAGGGAGG + Intronic
1023049525 7:36239062-36239084 ATTCACAAACCAAGAACGGAGGG + Intronic
1023723911 7:43122455-43122477 ACTCAGAGACCCAGAAAGGGGGG + Intronic
1024271807 7:47648220-47648242 ATACATAGGCCCTGAAAGGAAGG - Intergenic
1025895847 7:65699788-65699810 ATTCAGGAGCACAGGCAGGATGG + Intergenic
1026511090 7:71027847-71027869 ATTCAGGACCCCAGAGAGCAGGG - Intergenic
1030411294 7:109183251-109183273 AGTCAGAGACCCCGAAAGGAGGG - Intergenic
1032026163 7:128444244-128444266 CTTCCCAAGCCAAGAAAGGAGGG - Intergenic
1032508787 7:132455650-132455672 ATTTCGAAGCCCAGAAAGAAAGG - Intronic
1033644728 7:143292433-143292455 ATGCTGAAGCCCAGAAAGGGTGG - Exonic
1033741683 7:144280984-144281006 ATTCAGCAACCCTGAAAGGTAGG + Intergenic
1033752218 7:144368630-144368652 ATTCAGCAACCCTGAAAGGTAGG - Intronic
1034293979 7:149955474-149955496 TTTCAGCAGCTCAGAAAGCAAGG + Intergenic
1034812091 7:154141394-154141416 TTTCAGCAGCTCAGAAAGCAAGG - Intronic
1035606287 8:931709-931731 TTTCAGCAGCCCAGTAAGAAGGG - Intergenic
1036543934 8:9748103-9748125 ATGAAGCAGCCCAGAAAGGAAGG + Exonic
1036680005 8:10865058-10865080 ATTCAGAAGGCAAGTAAGGTGGG - Intergenic
1037070216 8:14636666-14636688 TATCAGAAGCTCAGGAAGGAAGG + Intronic
1037499870 8:19475226-19475248 ATGCAGAAGCCGAGAAAGTCTGG + Intronic
1037678863 8:21076366-21076388 CCCCAGCAGCCCAGAAAGGATGG + Intergenic
1037756676 8:21714728-21714750 ACACAGAAGCTCAGAAAGGCTGG + Intronic
1037916074 8:22774260-22774282 ATGCAGAAGCCCAAAAGGAAGGG - Intronic
1037950460 8:23015931-23015953 AATGAGAAGCCCAGAGAGGCAGG - Intronic
1039261417 8:35775777-35775799 ATCCAGAAGCCAAGAACGAAGGG + Intronic
1039580846 8:38665835-38665857 AATCAGAATCCCAGGGAGGAAGG - Intergenic
1041664978 8:60434542-60434564 AGTCAGGAACCCTGAAAGGAGGG - Intergenic
1042117643 8:65449557-65449579 ATTATGAAGCCCAAAAAGGAGGG + Intergenic
1042734511 8:71972864-71972886 ACTCAGAAGTGCAGAAAGGAAGG + Intronic
1042937583 8:74076063-74076085 ATTCAGCGACCGAGAAAGGAGGG - Intergenic
1044147119 8:88730745-88730767 ATTCAGATGCCCTGAAAATAGGG - Intergenic
1044306263 8:90645123-90645145 ATTCTGAAGCCCAAAAGGTATGG + Exonic
1045058463 8:98390650-98390672 CATCAGAGACCCAGAAAGGAAGG - Intergenic
1045103652 8:98869538-98869560 TTTGAGAAACACAGAAAGGAAGG + Intronic
1045599293 8:103694498-103694520 ATTCAGTAGCCCAGGATGGCTGG + Intronic
1046882484 8:119324570-119324592 ATACGGAAGACCAGAAAGGAAGG + Intergenic
1046964997 8:120154202-120154224 ATTCAGATGAGAAGAAAGGAAGG + Intronic
1047902955 8:129443664-129443686 ATTCAGCATCTCAGAATGGAGGG + Intergenic
1049274526 8:141713135-141713157 CTGCAGAAGCTCAGAAAGGGAGG + Intergenic
1051036574 9:12754089-12754111 AGCCAGAAGCCCAGAAAAGAGGG - Intergenic
1051385064 9:16498893-16498915 ATCCAGTAGCCCAGAGAAGATGG - Intronic
1052340714 9:27361832-27361854 TTTGAGCTGCCCAGAAAGGAAGG - Intronic
1052595475 9:30552268-30552290 ATCCAGTAGCCCACCAAGGATGG - Intergenic
1053025627 9:34726111-34726133 ATTCAGAAACCCAGAAGGTCTGG + Exonic
1053037155 9:34835173-34835195 ATTCAGAAACCCAGAAGGTCTGG + Intergenic
1053120115 9:35539954-35539976 ATTCAGAAGGCCAAAAAAGAGGG + Intronic
1053161849 9:35818825-35818847 AGTCAGAAGGCCAGGCAGGAAGG - Intronic
1055277631 9:74636993-74637015 ATTCAAAAGCCCTGAAATTATGG + Intronic
1056708988 9:88975466-88975488 ATTCAGATGTCAAGAAAGCAAGG - Intergenic
1056724757 9:89104919-89104941 TTTCTGAAGCACAGAAAGGAGGG + Intronic
1057458130 9:95233110-95233132 ATTAAGAAGGCGGGAAAGGAGGG + Intronic
1057474352 9:95385982-95386004 AGAAAGAAGCACAGAAAGGACGG - Intergenic
1057808783 9:98241582-98241604 ATGCAGAGACCAAGAAAGGAAGG - Intronic
1058861111 9:109118950-109118972 ATTCAGATGCGCAGAACTGAGGG + Intronic
1058927552 9:109682524-109682546 ATTCTGAGGCCCAGAGAGAAAGG + Intronic
1060214884 9:121732779-121732801 AAGCAGAAGCACAGAAAGGTTGG - Intronic
1060787880 9:126464836-126464858 AGTCTGAAGCCCAGAAGGGAAGG - Intronic
1061120190 9:128637201-128637223 TTCCAGAAGCCCAGAAGGCATGG + Intronic
1061895160 9:133643330-133643352 ATTCGGAAGCCCATGGAGGAGGG + Intronic
1062004629 9:134233057-134233079 ACTCAGGAGCCCAGAAGGGGCGG - Intergenic
1062195560 9:135271796-135271818 CTTCGCAAGCCCATAAAGGAGGG - Intergenic
1187344146 X:18447672-18447694 ATCAAGAAGCCCACACAGGAGGG - Intronic
1187504670 X:19869172-19869194 AATCAGAAGTCCAGAATGGGTGG - Intronic
1188824537 X:34814870-34814892 ATTCAGAAGGCTGGAAAGTAAGG - Intergenic
1190572207 X:51794739-51794761 ATCCAGAAATCCAGAAATGAAGG - Intergenic
1190784605 X:53632902-53632924 AATAAGAATCCAAGAAAGGATGG + Intronic
1192005698 X:67209762-67209784 ATTCAAATGCCCTGCAAGGAAGG + Intergenic
1192314647 X:70042406-70042428 CTTCTGAAGCCCAGAAAGGTAGG + Intronic
1193092648 X:77510864-77510886 AATCTGCAGCCCAGAAGGGAAGG + Intronic
1193297026 X:79845621-79845643 ACACATAAGCCCAGACAGGAAGG - Intergenic
1195014895 X:100768815-100768837 ATACAAAAGCCCAGACAGGAAGG - Intergenic
1198622225 X:138525978-138526000 ATTCTGCAACCAAGAAAGGAGGG - Intergenic
1199664574 X:150086541-150086563 AAACAGAAGCTCAGAAAGAAAGG - Intergenic
1200107405 X:153722916-153722938 ATTCTGAAGACCAGAAGGCAGGG + Intronic
1200760899 Y:7038245-7038267 AATAAGAACCACAGAAAGGATGG - Intronic
1201447476 Y:14073922-14073944 ATACAGAACCCGAGAAAGGCGGG - Intergenic