ID: 954809904

View in Genome Browser
Species Human (GRCh38)
Location 3:53241340-53241362
Sequence AAATGGATGCTGCAGTTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 288}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954809904_954809911 -1 Left 954809904 3:53241340-53241362 CCGGCCAACTGCAGCATCCATTT 0: 1
1: 0
2: 2
3: 26
4: 288
Right 954809911 3:53241362-53241384 TCAGGGGAGGAAGCAAGTGAAGG 0: 1
1: 0
2: 3
3: 63
4: 538

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954809904 Original CRISPR AAATGGATGCTGCAGTTGGC CGG (reversed) Intronic
900774333 1:4570743-4570765 CAATGGATGCTGGAGTTCACTGG - Intergenic
900788316 1:4663559-4663581 AAATGCAGGCTGCAGGTGGGAGG + Intronic
900945718 1:5830444-5830466 AAATGGTACCTGCAGTTGGCTGG - Intergenic
901254661 1:7812328-7812350 AAATTGAAGCTGCAGGTGGCCGG + Intronic
902152138 1:14452007-14452029 AGACGGAGGCTGCAGTGGGCCGG - Intergenic
902393940 1:16122228-16122250 CAATGGACCCTGCAATTGGCAGG - Intergenic
905342547 1:37289273-37289295 AGATGTAGGCTGCGGTTGGCTGG - Intergenic
905367368 1:37460409-37460431 AAATTGAGGCTGCAGTGAGCTGG + Intergenic
913001151 1:114581950-114581972 AACTGGCTGCAGCATTTGGCGGG + Intergenic
913515365 1:119600966-119600988 AAAGGGATGCTGGAGGAGGCAGG + Intergenic
913530977 1:119734137-119734159 AAATGGCAGCTGCAGCTGGAGGG - Intronic
914457290 1:147847787-147847809 AAATGGATGCTGCAGATGGATGG + Intergenic
914854058 1:151337321-151337343 AAATGGAGGTTGCAGTGAGCCGG + Intergenic
914866294 1:151432277-151432299 AAATGTATGTTCCACTTGGCAGG + Intronic
915049093 1:153049128-153049150 CCAGGGATGCTCCAGTTGGCAGG + Intergenic
915053436 1:153102741-153102763 CCAGGGATGCTCCAGTTGGCAGG + Intronic
915610702 1:156989716-156989738 AAATGTGTGCTGCAGTGGTCAGG - Intronic
916274066 1:162974816-162974838 AAATGGAGGATGGAATTGGCTGG + Intergenic
916985840 1:170191061-170191083 ATAGGGCTGCTGCAGTTTGCTGG + Intergenic
917330249 1:173872935-173872957 AAGTGGAGGTTGCAGTTAGCTGG + Intronic
919404922 1:197167263-197167285 AAATTGAGGCTGCAGTGAGCTGG - Intronic
922167035 1:223124671-223124693 AAGTGGAGGCTGCAGTGAGCTGG - Intronic
922390688 1:225138283-225138305 AAACGGCTGTTGCAGCTGGCAGG - Intronic
1063962275 10:11316618-11316640 TAATGGCTGCTGCAGTGGGGTGG - Intronic
1065312164 10:24427016-24427038 AAAAGCAGGGTGCAGTTGGCAGG - Intronic
1065608664 10:27448065-27448087 AAATGGAATCTGCATATGGCAGG - Intergenic
1067013808 10:42740107-42740129 ATATGGATGCTGCTCTGGGCTGG + Intergenic
1068236914 10:54248517-54248539 AAATGCATTAAGCAGTTGGCAGG + Intronic
1068811060 10:61256757-61256779 GAAGGGCTGCTGCAGTTTGCTGG + Intergenic
1068895171 10:62190934-62190956 GAATGGATAAGGCAGTTGGCTGG - Intronic
1070999830 10:80818758-80818780 GCATGGCTGCTGCAGTTTGCTGG - Intergenic
1071134466 10:82437809-82437831 ATAGGGCTGCTGCAGTTTGCTGG + Intronic
1072987475 10:100154039-100154061 AAGTGGATGATGCAGTTTGAAGG - Intronic
1075418455 10:122282963-122282985 AGATGAAAGCAGCAGTTGGCAGG + Intronic
1076933097 10:133546815-133546837 ACAGGGTTGCTGCAGTTTGCTGG - Intronic
1077078497 11:712214-712236 AAATGGAGGTTGCAGTGAGCCGG + Intronic
1077434847 11:2534032-2534054 CAGTGGAGGCTGCAGCTGGCGGG - Intronic
1078501764 11:11885977-11885999 ATAGGGCTGCTGCAGTTTGCTGG - Intronic
1082680290 11:56159616-56159638 AAATGCATTCTGCAGAGGGCAGG - Exonic
1085136822 11:74098014-74098036 CAACAGATGCTGCAGTTGGCTGG + Exonic
1087626826 11:100604674-100604696 GTATGGCTGCTGCAGTTTGCTGG - Intergenic
1089463360 11:118666161-118666183 AAGTGGAGGTTGCAGTGGGCCGG + Intronic
1089541357 11:119190809-119190831 AAAGGGAGGCTGCAGCTGCCCGG - Exonic
1090117013 11:123984394-123984416 ATAGGGATGCTGCGGTTTGCTGG + Intergenic
1091578327 12:1760905-1760927 ATATCCATGCTGCAGATGGCTGG + Intronic
1094163574 12:27418681-27418703 AAATGGATGCTACCATTGGCTGG + Intronic
1094273248 12:28640625-28640647 AAATTGATGCTGCAGGTTCCTGG + Intergenic
1095320289 12:40818941-40818963 ATAGGGCTGCTGCAGTTTGCCGG + Intronic
1095700095 12:45182319-45182341 AAATAGACTCTGGAGTTGGCCGG - Intergenic
1096829378 12:54302213-54302235 AAATGTAAGCTGCAGATGTCAGG - Intronic
1097319047 12:58205295-58205317 AAATGGATGCTGGGGGTGGGAGG - Intergenic
1098307785 12:69118681-69118703 AAATGGATGGTGCAGGAGACAGG - Intergenic
1099437089 12:82658121-82658143 AAATGGAGGCTGCAGGAGGAAGG + Intergenic
1099783323 12:87228868-87228890 AAGTGGATGTTGCAGTGAGCCGG - Intergenic
1103717784 12:122955779-122955801 AGGTGGAGGCTGCAGTTAGCTGG - Intronic
1104565790 12:129880597-129880619 AATTGGAATATGCAGTTGGCAGG + Intronic
1104769739 12:131353939-131353961 GAGTGGTTGCTGCAGGTGGCAGG - Intergenic
1106021868 13:25923223-25923245 AAATTGCTGCTGCTCTTGGCAGG - Intronic
1106040154 13:26082712-26082734 AAATGGAAGCTTCTGTTGGCAGG + Intergenic
1106152836 13:27122580-27122602 AAGTGGAAGCTGCAGTGAGCCGG + Intronic
1106789445 13:33139649-33139671 AAATAAATACTGAAGTTGGCTGG + Intronic
1109386890 13:61641922-61641944 AAATGTATTCTGCAGTTGCATGG + Intergenic
1109968848 13:69738127-69738149 ATAGGGATGCTGCAGTTTGGTGG - Intronic
1114616737 14:24072450-24072472 AAGTGGAGTCTGCAGTGGGCAGG - Intronic
1115439054 14:33411062-33411084 AGATGCATGCTACAGTTGACAGG - Intronic
1115492277 14:33968947-33968969 AAATTGATGCTGCTGCTGGGAGG - Intronic
1116410414 14:44615058-44615080 AAATTTATGCTGGAGTTTGCAGG - Intergenic
1116419080 14:44712565-44712587 AAAAGGAGGCTGCAGCAGGCAGG - Intergenic
1117751149 14:58924644-58924666 ACAGGAATGCTGCAGTTTGCTGG - Intergenic
1117857466 14:60050829-60050851 ATAGGGCTGCTGCAGTTTGCTGG + Intronic
1119176044 14:72568329-72568351 AAATGGGTGCTGGTGTTAGCTGG + Intergenic
1119505872 14:75172669-75172691 AGATGCATGCTGAAGTAGGCAGG + Intronic
1120283179 14:82464371-82464393 ATAGGGTTGCTGCAGTTTGCTGG - Intergenic
1121142510 14:91555534-91555556 ACAGGGCTGCTGCAGTTTGCTGG - Intergenic
1121222871 14:92299567-92299589 AAGTGGACGCAGGAGTTGGCAGG - Intergenic
1123061543 14:105596942-105596964 AAATGGGGGCTGCAGGTGGATGG + Intergenic
1124076294 15:26448177-26448199 AAATGGATGCTTCTGTTTGGAGG - Intergenic
1124190545 15:27572851-27572873 ATATGTGTGCTGCAGTTGGATGG + Intergenic
1124190552 15:27572897-27572919 ATATGTGTGCTGCAGTTGGATGG + Intergenic
1124190559 15:27572943-27572965 ATATGTGTGCTGCAGTTGGATGG + Intergenic
1124497413 15:30194873-30194895 AAAAGCATGCTTCAGTTGGCTGG - Intergenic
1124746160 15:32343774-32343796 AAAAGCATGCTTCAGTTGGCTGG + Intergenic
1124973934 15:34516201-34516223 AAAAGCATGCGTCAGTTGGCTGG + Intergenic
1125680286 15:41526315-41526337 AGGTGGAGGCTGCAGTGGGCTGG - Intronic
1126956339 15:53936761-53936783 ATAGGGCTGCTGCAGTTTGCTGG - Intergenic
1127232607 15:57013378-57013400 AAGTGGAGGTTGCAGTTAGCCGG - Intronic
1128663482 15:69521078-69521100 AAATGGGTTCTGCAGATGGCTGG + Intergenic
1129480574 15:75821921-75821943 AAGAGCATGCTTCAGTTGGCTGG - Intergenic
1130030297 15:80308007-80308029 ATAGGGCTGCTGCAGTTTGCTGG + Intergenic
1130982060 15:88819464-88819486 AAATGAAATCTGGAGTTGGCTGG + Intronic
1131554719 15:93387039-93387061 GAATGGATGCTCCAGTTTCCTGG + Intergenic
1132186332 15:99804873-99804895 AAGAGCATGCTTCAGTTGGCTGG - Intergenic
1132429345 15:101747833-101747855 AAGAGCATGCTTCAGTTGGCTGG + Intergenic
1133965175 16:10526008-10526030 CAATGGACGCTTCATTTGGCCGG + Intergenic
1134400591 16:13906286-13906308 ATCTTGATGCTGCCGTTGGCTGG + Intergenic
1136645425 16:31609501-31609523 ATAGGGCTGCTGCAGTTTGCTGG - Intergenic
1137764358 16:50966697-50966719 CAATGGATGCTGGAGTTGGCAGG - Intergenic
1139377795 16:66511285-66511307 AAAATTATGCTGCATTTGGCTGG - Exonic
1140505980 16:75473037-75473059 AATTGGAAGCTGCAGGTGCCAGG + Exonic
1141671514 16:85494520-85494542 AAGTGGAGGCTGCAGTGAGCTGG - Intergenic
1141975808 16:87515741-87515763 TGCTGGGTGCTGCAGTTGGCGGG - Intergenic
1142855301 17:2725860-2725882 AGAAGGATGCTGCAGATGGAGGG + Intergenic
1146700080 17:34949932-34949954 GAATGTATGCTGCAGTTGGTAGG - Intronic
1148606356 17:48932148-48932170 AGATGGAGGCTGCAGTGAGCCGG + Intronic
1149485549 17:57039958-57039980 AAATGGAGCCTGGAGGTGGCAGG - Intergenic
1149589014 17:57813803-57813825 AAGTGGAAGCTGCAGTGAGCCGG + Intergenic
1150190376 17:63232511-63232533 ATAGGGCTGCTGCAGTTTGCTGG + Intronic
1150454806 17:65298672-65298694 AAATGAAAGCTGCAAGTGGCAGG - Intergenic
1150518375 17:65838175-65838197 AAATGTCTGCAGCAGTTGGGTGG - Intronic
1150604813 17:66681762-66681784 GAATGGGTGCTGCAGGTGGTGGG - Intronic
1150875067 17:68961776-68961798 AAATGTATGCTGCACCTGGGAGG + Intergenic
1154262260 18:12846327-12846349 AAATGGATACTAAAGTTGGTGGG - Intronic
1155259411 18:24026781-24026803 GAATGGCTGCTGCAGATGGAAGG - Intronic
1156694920 18:39754238-39754260 ATAGGGCTGCTGCAGTTTGCTGG - Intergenic
1159733101 18:72056251-72056273 AAGTGGAGGCTGCAGGTGCCTGG - Intergenic
1159858180 18:73614489-73614511 GAATGGATGCTGAAGTTGAAGGG + Intergenic
1159983116 18:74810237-74810259 AAGTGGATGCTGCGGTGGACTGG + Intronic
1160419290 18:78733026-78733048 AAATGGGTGCTGCACCTGCCTGG + Intergenic
1162057255 19:8072022-8072044 ACATGGGTGCTGCACTAGGCAGG - Intronic
1162546818 19:11335790-11335812 AAATGGCAGTGGCAGTTGGCTGG + Intronic
1164188530 19:22894297-22894319 AAGTGGAGGCTGCAGTTAGACGG - Intergenic
1165351841 19:35279923-35279945 TAATGGGTGGTGCAGCTGGCAGG - Intergenic
1166597542 19:44063303-44063325 AAATGAATGCTGGAATTGGCTGG + Intronic
1166646687 19:44537335-44537357 AAAAGTATCCTGCAGGTGGCTGG - Intergenic
1167090193 19:47338765-47338787 AGATGGAGGCTGCAGTGAGCTGG + Intronic
926801120 2:16661572-16661594 GAATTGCTTCTGCAGTTGGCTGG - Intronic
930189397 2:48441731-48441753 AAAAGGATGCTGCAGTTTCTGGG + Intronic
930942381 2:57028257-57028279 AAGTGGGTGCTGCAGATGTCTGG + Intergenic
930951439 2:57147470-57147492 AACAGGCTGCTGCAGTTTGCTGG - Intergenic
934618244 2:95788683-95788705 AAATGGATTCTGCAGGTACCGGG + Intergenic
934642649 2:96035876-96035898 AAATGGATTCTGCAGGTACCGGG - Intronic
936607768 2:113975208-113975230 AACTGAATGCTGCGGCTGGCCGG + Intergenic
937239593 2:120451613-120451635 AAATGGGAGCTGCTATTGGCTGG - Intergenic
937893854 2:126962869-126962891 ATAGGGCTGCTGCAGTTTGCTGG + Intergenic
937953116 2:127403533-127403555 ACCTGGAGGCTGCAGTTGGGAGG - Intergenic
938136721 2:128765387-128765409 ATAGGGCTGCTGCAGTTTGCTGG + Intergenic
938606601 2:132899803-132899825 AGATGGAGGCTGCAGTGAGCTGG + Intronic
938613694 2:132975601-132975623 AAAGGTATGCTCCAGGTGGCTGG + Intronic
940124695 2:150310417-150310439 ATAGGGCTGCTGCAGTTTGCTGG - Intergenic
940446839 2:153786321-153786343 AAATGGTGGCTGCAGTGTGCTGG - Intergenic
940906127 2:159171552-159171574 AAATGAAGGCTGCAGTGAGCTGG + Intronic
942765167 2:179446660-179446682 AAGTGGCTGCTCCAGGTGGCAGG + Exonic
942947478 2:181685349-181685371 CAATGGTTGCTGCAGTGGGTTGG + Intergenic
943339374 2:186660524-186660546 AAATGGATGCTTCATTTCACTGG + Intronic
945525438 2:210883164-210883186 ATAAGGATGGTGGAGTTGGCTGG + Intergenic
945714203 2:213337110-213337132 ACAGGGATGTTGCAGTTTGCTGG - Intronic
946396118 2:219444555-219444577 AGATGGAGCCTGCTGTTGGCAGG + Intronic
947676382 2:231984687-231984709 AGATAGAAGTTGCAGTTGGCTGG - Intronic
948260281 2:236599249-236599271 AGAAGCAGGCTGCAGTTGGCAGG - Intergenic
948458781 2:238119301-238119323 AAATGGATGAAGGAGTTGGATGG + Intronic
1169478009 20:5950003-5950025 AAAAGGATGCTGAAGGTGGACGG + Intronic
1169495908 20:6114941-6114963 AAATGTAAGCTCCAGGTGGCAGG + Intronic
1169695667 20:8384787-8384809 ATAGGGCTGCTGCAGTTTGCTGG + Intronic
1170155148 20:13262331-13262353 AACTGGATGCTGAGGATGGCTGG + Intronic
1170709712 20:18779300-18779322 AAATGGGTGCCGGAGTTGGGGGG - Intergenic
1171023338 20:21607107-21607129 AAATGAATGGTGCAGTGGGTTGG + Intergenic
1172445394 20:34990665-34990687 AATTGGATGCCGCAGTGGTCAGG - Intronic
1173836886 20:46131827-46131849 AGATGGAGGCTGCAGTGAGCTGG - Intergenic
1174326459 20:49782910-49782932 AAGTGGATCCTGCACTAGGCGGG - Intergenic
1174953240 20:55066706-55066728 ATAGGGCTGCTGCAGTTTGCTGG + Intergenic
1175616201 20:60401152-60401174 AAATGCATTCTGCAATTGTCAGG + Intergenic
1177702646 21:24658253-24658275 AAATGGGTGCTGCTGGTGGATGG - Intergenic
1177956483 21:27605653-27605675 ATAGGGCTGCTGCAGTTTGCAGG + Intergenic
1178831469 21:36060370-36060392 AGATGGAGGCTGCAGTGGGCGGG + Intronic
1181493643 22:23275883-23275905 AAATGGCAGCTGCAGTTGCAGGG - Intronic
1182556033 22:31128749-31128771 AAATGGATGCTGCTGAGGGCAGG - Intronic
1184566933 22:45297733-45297755 AAATGGAGGCTGCAGGAGGTGGG - Intergenic
950055493 3:10020881-10020903 AAATGGATGGTGGTGATGGCTGG + Intergenic
950189161 3:10964717-10964739 TCATGGATGCGGAAGTTGGCGGG - Intergenic
950450847 3:13064535-13064557 AGATGGATGCTGGAGTTCACTGG + Intronic
951601894 3:24386066-24386088 AGGTGGATGCTGGATTTGGCTGG - Intronic
951996489 3:28736024-28736046 ATAGGGCTGCTGCAGTTTGCTGG + Intergenic
952753676 3:36847099-36847121 AAATGGAGCTTGCACTTGGCTGG - Intronic
953850729 3:46463975-46463997 AAGTGGAGGCTGCACTGGGCTGG + Intronic
954809904 3:53241340-53241362 AAATGGATGCTGCAGTTGGCCGG - Intronic
955122218 3:56071993-56072015 GTATGGCTGCTGCACTTGGCTGG - Intronic
955747066 3:62150391-62150413 AAATGGATGCTGCTGGTCTCAGG - Intronic
955818943 3:62875473-62875495 AAAGGGCTGCTGCAGAGGGCTGG + Intergenic
956784557 3:72631634-72631656 AGATGGAGGCTGCATTTGGATGG - Intergenic
960288884 3:115860390-115860412 TGAAGGATGCTACAGTTGGCTGG + Intronic
960554141 3:119008908-119008930 GAAGTGATGTTGCAGTTGGCAGG - Intronic
961431583 3:126887804-126887826 AAAAGGATGCTCCAGCTGGGTGG - Intronic
962224582 3:133595029-133595051 AAGTGGATACTGAAGTTGGAGGG + Intergenic
962305258 3:134280598-134280620 CAGTGGATACTGCTGTTGGCTGG + Intergenic
962420462 3:135224644-135224666 CAATGGATGCTGAAATTGGGGGG - Intronic
962984363 3:140521373-140521395 ATAGGGCTGCTGCAGTTTGCTGG + Intronic
963280023 3:143375079-143375101 AACTGGATTCTGCAGTTGTTTGG + Intronic
963416165 3:144998681-144998703 GAATGGCTGCTGCAGTTTGCTGG + Intergenic
964910245 3:161772244-161772266 CCATTGATGCTGCTGTTGGCAGG - Intergenic
967234214 3:187368511-187368533 ACATGGACGCTGAAGTTGGATGG + Exonic
967722615 3:192831244-192831266 AAGTTGGTGCTGCAGTTGGGAGG - Intronic
967928838 3:194675272-194675294 AAATGGTTTCTGCAGTTGGAGGG - Intergenic
968626247 4:1627948-1627970 CACTGGATGCTGCCGTTGACAGG - Intronic
969045178 4:4331445-4331467 AACTGGATGCTCCGGTTGACAGG + Intergenic
971413034 4:26395378-26395400 AAATTGAGGCTGCAGTGAGCCGG + Intronic
971613810 4:28761382-28761404 AAGTGGAGGCTGCAGTGAGCTGG + Intergenic
972022037 4:34327225-34327247 AAAGGGCTGCTGCAGTTTGCTGG + Intergenic
972583647 4:40417170-40417192 AAATCGAGGCTGCAGTGAGCAGG + Intergenic
974271574 4:59656799-59656821 ATAGGGCTGCTGCAGTTTGCTGG - Intergenic
974836837 4:67261346-67261368 AAAGGGATGCTTCTGATGGCAGG + Intergenic
975765679 4:77665343-77665365 AATTGGAGGTTGCAGTTAGCAGG - Intergenic
976480066 4:85532108-85532130 TAATGGATGCTGCTGTTTTCAGG + Intronic
977971413 4:103218090-103218112 ATATGGCTGCTGCAGTATGCTGG - Intergenic
980752118 4:137104430-137104452 AAAAGCATTCTGCAGTTGGATGG + Intergenic
980792300 4:137635125-137635147 AAATGGATGTTTTCGTTGGCTGG + Intergenic
981386594 4:144138587-144138609 AAATGGATTCTCCATTTGGAAGG + Intronic
982326998 4:154138065-154138087 AAGGGGTTTCTGCAGTTGGCTGG + Intergenic
982570113 4:157038596-157038618 AGATGGAAGCTGCAGTGAGCTGG + Intergenic
983317720 4:166153342-166153364 TAAAGAATGCTGCAGTTGCCAGG + Intergenic
984723439 4:182998223-182998245 ATAGGGCTGCTGCAGTTTGCTGG - Intergenic
987453966 5:18120084-18120106 ACAGGGCTGCTGCAGTTTGCTGG - Intergenic
987530714 5:19115460-19115482 ATAGGGATGCTGCAGTTTGCTGG - Intergenic
988964411 5:36402061-36402083 AAAAGGATCCTGTAGTTGGCAGG + Intergenic
989305541 5:39951088-39951110 ATAGGGCTGCTGCAGTTTGCTGG - Intergenic
991157798 5:63459103-63459125 AAAGGGCTGCTGCAGTATGCTGG - Intergenic
992248640 5:74855263-74855285 AGATGGAGGCTGCAGTGAGCTGG - Intronic
992752670 5:79875339-79875361 CAATGGACGCTGCAGTCTGCCGG + Intergenic
994090395 5:95804782-95804804 AACTGCTTGCTGCAGTTAGCAGG + Intronic
994298896 5:98122266-98122288 ATAGGGCTGCTGCAGTTTGCTGG - Intergenic
995258211 5:110072161-110072183 ACAGGGTTGCTGCAGTTTGCTGG + Intergenic
996482132 5:123987869-123987891 ATAAGGCTGCTGCAGTTTGCTGG + Intergenic
996778524 5:127159345-127159367 ACAGGGCTGCTGCAGTTTGCTGG + Intergenic
996965806 5:129306278-129306300 GTATGGCTGCTGCAGTTTGCTGG + Intergenic
997360820 5:133293668-133293690 TACTGGATGCTGCATCTGGCCGG - Intronic
998453714 5:142254125-142254147 CTGTGGTTGCTGCAGTTGGCAGG + Intergenic
1001509432 5:172308698-172308720 AAGTCGAGGCTGCAGTTAGCTGG + Intergenic
1001570571 5:172727960-172727982 AAATGGAAGCTGCAGAGGGCAGG - Intergenic
1001621269 5:173087399-173087421 AAAAGTATGCAGCTGTTGGCTGG + Intronic
1002476671 5:179470293-179470315 TAATGGACGCAGCAGCTGGCTGG - Intergenic
1002897282 6:1386799-1386821 AAATGGATACTGCTGTTGCTTGG + Intergenic
1003248855 6:4406523-4406545 AAAGGGCTGCTGCTGTTTGCTGG - Intergenic
1003506907 6:6747490-6747512 AAATGGATGCTTCTGCTTGCAGG + Intergenic
1006712263 6:36084083-36084105 ATAGGGCTGCTGCAGTTTGCTGG - Intronic
1010962870 6:82166519-82166541 CAATGGATACTGCAGTTAGTTGG + Intergenic
1013016135 6:106162092-106162114 AAATTGAGGCTGCAGTGAGCCGG - Intergenic
1014307198 6:119757742-119757764 AAATGAATGCTGCAGTAGAGTGG - Intergenic
1017257492 6:152350241-152350263 AAGTGGCTGCTGCAGATGTCTGG - Exonic
1018194404 6:161342414-161342436 AAATGGATGTTGCTGTTGATAGG + Intergenic
1018417916 6:163617357-163617379 AGGTGGAGGCTGCAGTGGGCCGG + Intergenic
1018556238 6:165053157-165053179 AGTTGGATGCTGCAGTCTGCTGG + Intergenic
1018578353 6:165283708-165283730 ATAGGGCTGCTGCAGTTTGCTGG - Intronic
1019146399 6:169978026-169978048 AAATGGATGCTCCTTTTGGATGG + Intergenic
1019244406 6:170698420-170698442 AAATGTATCCTGAACTTGGCCGG + Intergenic
1022593551 7:31689450-31689472 AAAGGGATGCTGCACTTGTTGGG - Intronic
1022856810 7:34322998-34323020 AAAAGGATGATGCAGATGGATGG - Intergenic
1023234314 7:38067869-38067891 CAAGGGATCCTGCAGTTGTCTGG - Intergenic
1023384587 7:39643355-39643377 AAAAGGATGCTGCTGCAGGCAGG + Intronic
1025041800 7:55651879-55651901 ATAGGGCTGCTGCAGTTTGCTGG - Intergenic
1026376921 7:69761141-69761163 AAATGCATGCTTCAGCTGCCTGG + Intronic
1028136879 7:87231333-87231355 CGCTGGCTGCTGCAGTTGGCTGG - Intergenic
1029428418 7:100512660-100512682 ATATAGATTATGCAGTTGGCGGG + Intergenic
1029541508 7:101185505-101185527 GAATTGCTGCTCCAGTTGGCTGG - Intergenic
1030438315 7:109552799-109552821 ATAAGGCTGCTGCAGTTTGCTGG - Intergenic
1030830129 7:114210397-114210419 ATAGGGCTGCTGCAGTTTGCTGG + Intronic
1031004010 7:116451862-116451884 AAATGGATGCTGCAGGAGAGGGG - Intronic
1032804900 7:135343604-135343626 AAATGGATGCCACAGTTGCAAGG + Intergenic
1034324699 7:150220176-150220198 AGATGGAGGCTACAGTTGGCGGG - Intergenic
1034442784 7:151095424-151095446 AAAGGGAAGCTGCTGTAGGCAGG - Intronic
1034482709 7:151335043-151335065 AAATGGATGCTGCTGATTGCTGG - Intergenic
1034768492 7:153749055-153749077 AGATGGAGGCTACAGTTGGCCGG + Intergenic
1034818449 7:154195362-154195384 AAATGGAAACTGCCATTGGCTGG + Intronic
1034818456 7:154195400-154195422 GAATGGAAACTGCCGTTGGCTGG + Intronic
1035503719 8:109752-109774 AAATGTATCCTGAACTTGGCCGG - Intergenic
1037468216 8:19181870-19181892 AAATGGAAGATCCAGTTAGCTGG - Intergenic
1038436772 8:27541780-27541802 GGATGGATGCTGCAGTTCCCTGG - Intronic
1038706820 8:29901927-29901949 GTAGGGATGCTGCAGTTTGCTGG - Intergenic
1038977994 8:32723249-32723271 AAATGAACACTGAAGTTGGCTGG - Intronic
1039501002 8:38017104-38017126 AAGTGGAGGTTGCAGTTTGCTGG + Intergenic
1039637017 8:39178784-39178806 ATAGGGCTGCTGCAGTTTGCTGG + Intronic
1040897601 8:52385172-52385194 AAATGTATGTTGAAGCTGGCAGG + Intronic
1041143020 8:54843011-54843033 AAAGGGATGCCACAGTTGGGAGG - Intergenic
1042333427 8:67606522-67606544 AAAGGGAGGCTGCAGGGGGCAGG - Intronic
1044356045 8:91224445-91224467 GTAGGGCTGCTGCAGTTGGCTGG + Intronic
1044515282 8:93130440-93130462 AAATGGATGCTGCATGTGGAAGG + Intergenic
1047058975 8:121200146-121200168 AGATGTCTGCTGCTGTTGGCAGG - Intergenic
1047477097 8:125243132-125243154 AAATGTATGATGCAGTTGAGGGG + Intronic
1047931022 8:129728359-129728381 AAGTGGATGCTCCAGATGCCCGG - Intergenic
1048636669 8:136303882-136303904 AAAAGGATTCTACAGTAGGCGGG - Intergenic
1049734522 8:144197729-144197751 TAAAAGATGCTGCAGTTGGCTGG - Intronic
1050080095 9:1906981-1907003 AAATGGATGCTGTGGTTGGTTGG - Intergenic
1050393191 9:5167959-5167981 ATAGGGTTGCTGCAGTTTGCTGG - Intronic
1051143946 9:14007313-14007335 AAAAGGATGCTGCAGTGGGTAGG + Intergenic
1051173621 9:14343507-14343529 AAAGGGATGTGGCTGTTGGCAGG + Intronic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1052736938 9:32352370-32352392 CCATGGAGGCTGCAGCTGGCAGG - Intergenic
1055476392 9:76667421-76667443 AAATGGGGGCTGCAGATGGCAGG - Intronic
1057095093 9:92299301-92299323 AACAGGATGTTGCAGTTGACTGG - Intronic
1057208551 9:93187126-93187148 ACAGGGGTGCTGCAGTAGGCTGG + Intronic
1057241562 9:93416418-93416440 ATAGGGCTGCTGCAGTTTGCTGG + Intergenic
1059260726 9:112973722-112973744 ATAGGGCTGCTGCAGTTTGCTGG - Intergenic
1061421395 9:130474652-130474674 CAGGGAATGCTGCAGTTGGCAGG + Intronic
1061488196 9:130930944-130930966 ATGTGGCTGCTGCAGTTGGAAGG - Intronic
1061967100 9:134021317-134021339 CAATGAAAGCTGTAGTTGGCTGG + Intergenic
1062030651 9:134360462-134360484 AAACGGAGGCTGCAGGCGGCGGG - Intronic
1203604594 Un_KI270748v1:47646-47668 AAATGTATCCTGAACTTGGCCGG + Intergenic
1186500577 X:10047370-10047392 AGATGGGTTCTGCAGATGGCAGG - Intronic
1187432007 X:19233778-19233800 AAATTGCTGCTGCAGTGGCCAGG - Intergenic
1188744743 X:33829043-33829065 ATAGGGCTGCTGCAGTTTGCTGG + Intergenic
1189100402 X:38183121-38183143 AGATGGAGGCTGCAGTAAGCCGG - Intronic
1189826721 X:44926138-44926160 AGATGGAGGCTGCAGTGAGCTGG - Intronic
1190124122 X:47688194-47688216 AAATGGATGCTAAAATTTGCAGG - Intergenic
1192718532 X:73668599-73668621 ATAGGGCTGCTGCAGTTTGCTGG + Intronic
1193039390 X:76988219-76988241 ATAGGGCTGCTGCAGTTTGCTGG - Intergenic
1193048282 X:77076400-77076422 GTAGGGCTGCTGCAGTTGGCTGG + Intergenic
1193073466 X:77331932-77331954 ATAGGGCTGCTGCAGTTTGCTGG + Intergenic
1193365066 X:80622666-80622688 ACAGGGCTGCTGCAGTTTGCTGG + Intergenic
1194444868 X:93975427-93975449 ACAGGGCTGCTGCAGTTTGCTGG + Intergenic
1194537075 X:95118906-95118928 ATAGGGCTGCTGCAGTTTGCTGG + Intergenic
1194830525 X:98618424-98618446 ATAGGGATGCTGCAGTTTGTTGG + Intergenic
1196042514 X:111220344-111220366 AAATGGATGCTGCAAAAGGAAGG - Exonic
1196558950 X:117123260-117123282 ACATGGATTCTTCAGTTAGCAGG - Intergenic
1197023105 X:121715707-121715729 ATAGGGCTGCTGCAGTTTGCTGG + Intergenic
1197570843 X:128148492-128148514 GTAAGGATGCTGCAGTTTGCTGG - Intergenic
1200256447 X:154585422-154585444 GAATGGATGCTGCAGATGCGGGG + Exonic
1200261322 X:154618981-154619003 GAATGGATGCTGCAGATGCGGGG - Exonic
1200598869 Y:5182173-5182195 GTATGGCTGCTGCAGTTTGCTGG + Intronic
1201302787 Y:12524527-12524549 AAAAGGTAGCTGTAGTTGGCTGG - Intergenic