ID: 954812582

View in Genome Browser
Species Human (GRCh38)
Location 3:53257114-53257136
Sequence GTGGTAGCCATGACAATGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954812578_954812582 20 Left 954812578 3:53257071-53257093 CCCTGCACAGGGGATGGGGATTA 0: 1
1: 0
2: 1
3: 16
4: 190
Right 954812582 3:53257114-53257136 GTGGTAGCCATGACAATGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 130
954812579_954812582 19 Left 954812579 3:53257072-53257094 CCTGCACAGGGGATGGGGATTAT 0: 1
1: 0
2: 1
3: 6
4: 112
Right 954812582 3:53257114-53257136 GTGGTAGCCATGACAATGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954812582 Original CRISPR GTGGTAGCCATGACAATGCC AGG Intergenic
901158912 1:7160104-7160126 GAGGTACCCATCACCATGCCCGG - Intronic
905236379 1:36552862-36552884 GTGCTGGCCATGACTATCCCAGG - Intergenic
905301724 1:36990317-36990339 GTGGTAGACATGTCTATGCAGGG - Intronic
907973947 1:59412842-59412864 GTGGTAACCATCCCAATGCCAGG - Intronic
910442524 1:87267311-87267333 GAGGCAGCCATGAGAATGCCTGG + Intergenic
910997217 1:93119015-93119037 GGGGCAGCCATCACAATTCCTGG + Intronic
913685351 1:121226586-121226608 GTGGTAACCATGTCAGAGCCAGG + Intronic
914037197 1:144014190-144014212 GTGGTAACCATGTCAGAGCCAGG + Intergenic
914152258 1:145053742-145053764 GTGGTAACCATGTCAGAGCCAGG - Intronic
915296301 1:154924170-154924192 GTGCGAGCCATTACCATGCCTGG - Intergenic
916079046 1:161220852-161220874 GTGGTAGCCATTTAAAGGCCTGG - Intergenic
918778910 1:188670976-188670998 GTGGAAGCCAAGGCCATGCCAGG - Intergenic
920472668 1:206245144-206245166 GTGGTAACCATGTCAGAGCCAGG + Intronic
922850948 1:228733766-228733788 GTGGTAGCCATTCCTATACCTGG + Intergenic
923443752 1:234048523-234048545 GTGGTAGCCCTGATAATCTCTGG - Intronic
1063815018 10:9761169-9761191 ATGGTAGCCGTGAAAATGCATGG - Intergenic
1065093549 10:22259337-22259359 GTGCTAGCCCTGGCAATGACTGG + Intergenic
1066042851 10:31568275-31568297 GTGGAAGCTATGACAAGCCCAGG - Intergenic
1066379393 10:34888522-34888544 GTGTGAGCCATCACCATGCCTGG + Intergenic
1067938996 10:50636532-50636554 CTGGAAGCCTTGACAATTCCAGG + Intergenic
1071312230 10:84353634-84353656 GTGGTAGCCATGCTAATTGCAGG - Intronic
1072416190 10:95248857-95248879 ATGGGAGCCATGACAACACCTGG - Intronic
1072673794 10:97450906-97450928 ATGGTAGCCAAGACAACTCCAGG - Intronic
1074403156 10:113158341-113158363 GCGGTAGGCATGCCTATGCCGGG + Intronic
1081526996 11:43934176-43934198 AGGGTTGCCATGACAATCCCAGG - Intronic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1083540591 11:63509203-63509225 GTGCTTGCCATGACTATGGCAGG - Intronic
1084905388 11:72342206-72342228 ATGGAAGACATGAAAATGCCTGG + Intronic
1085009290 11:73126195-73126217 CTGGTACCCATGACTATGCCTGG - Intronic
1088769154 11:113015591-113015613 CAGGTACCCATGACCATGCCTGG - Intronic
1088968975 11:114754676-114754698 GTGGTGGGTATGGCAATGCCAGG + Intergenic
1089326537 11:117661309-117661331 GAGGTAGCCATGGCAATGCAAGG + Intronic
1097223786 12:57465182-57465204 GTGGTCCCCATGACTCTGCCCGG + Exonic
1100797297 12:98196106-98196128 TTTGTGGCCATTACAATGCCAGG + Intergenic
1103368670 12:120402013-120402035 GTGGAAAGCATGACAAAGCCGGG - Intergenic
1105949652 13:25218146-25218168 CTGGTACCCAGGACAGTGCCTGG - Intergenic
1109705880 13:66092327-66092349 CTGGTAGACATGACTATGGCTGG + Intergenic
1120306262 14:82774334-82774356 TTGTTAGCCATGACAATACAAGG - Intergenic
1120481064 14:85049957-85049979 GTGGTAGCCCTGACTAAGCAAGG + Intergenic
1120504158 14:85333776-85333798 CTGGTAGTCATGATAATGGCAGG + Intergenic
1121635720 14:95452630-95452652 GTGTTTGCCATGGCAATGCTGGG - Intronic
1122206544 14:100150587-100150609 GTGAGAGCCATGACAGAGCCTGG + Intronic
1124175368 15:27418907-27418929 GTGGTTGCCATGACAACTCGGGG + Intronic
1125261669 15:37832917-37832939 GTGGTGGCCTTGGCAATGGCTGG - Intergenic
1132051747 15:98613158-98613180 ATGGCAGCCAGGGCAATGCCTGG + Intergenic
1132150417 15:99454658-99454680 GTGTTAGGCTTGGCAATGCCAGG - Intergenic
1136055513 16:27685785-27685807 GTGAGAGCAGTGACAATGCCAGG - Intronic
1139235901 16:65338709-65338731 GTGGCAGACATGACTAAGCCTGG - Intergenic
1143594959 17:7908690-7908712 TTGGTAGCCATGGCTATGCACGG + Exonic
1151108886 17:71652230-71652252 CTGGTAGTCATGACAGTGGCAGG - Intergenic
1153250849 18:3119934-3119956 GTGGCAGCCATGAACATGGCTGG - Exonic
1155715094 18:28932629-28932651 GGAAGAGCCATGACAATGCCAGG - Intergenic
1156356995 18:36350487-36350509 TTGGTGGCCAGGACATTGCCAGG - Intronic
1156903411 18:42327309-42327331 GTGGTAGCAATGGGAATGTCAGG - Intergenic
1157586934 18:48806985-48807007 GTGGCAGCCATTTCAAAGCCTGG - Intronic
1160043215 18:75364233-75364255 CTGGCAGCCATTACACTGCCTGG - Intergenic
1161455471 19:4367645-4367667 GTGAAAGCGATGACAATGACAGG + Intronic
1161970631 19:7577868-7577890 GTGTTAGCCACCACCATGCCCGG - Intergenic
1164614105 19:29655887-29655909 GTGGCAGCCATGAAAATGCATGG - Intergenic
1164800533 19:31072591-31072613 TTGGACACCATGACAATGCCGGG + Intergenic
1165379403 19:35467659-35467681 GTGGTAGGAAGGACACTGCCCGG - Intergenic
1166423392 19:42655252-42655274 GTTGTAGCCAAGACAATCCTGGG - Intronic
926089450 2:10041006-10041028 GTGGTGGCCAGGACAAGGGCTGG + Intergenic
928783631 2:34854782-34854804 CTGGTAGCCATGACCACTCCTGG - Intergenic
929476235 2:42252337-42252359 GTGGAAACCATCATAATGCCAGG - Intronic
939638505 2:144611451-144611473 CTGGTGGCCATTACAATGCCTGG - Intergenic
940005586 2:149006888-149006910 GTGGAAGCCATGACCATACATGG + Intronic
942539159 2:176997339-176997361 TTGCTACCCATTACAATGCCTGG + Intergenic
942868130 2:180699962-180699984 GGCCCAGCCATGACAATGCCAGG + Intergenic
948942580 2:241203676-241203698 CTGGGCGCCATGACGATGCCGGG + Intronic
1169794121 20:9443065-9443087 GTTGTTGCCATGACAACACCTGG + Intronic
1172221231 20:33276477-33276499 GTGGTTTCCATGTCAAGGCCAGG + Intronic
1172786128 20:37469944-37469966 ATGGGAGACATGACAATGTCAGG - Intergenic
1172842327 20:37909423-37909445 CTGGGACCCAGGACAATGCCCGG + Intronic
1173983049 20:47239716-47239738 CTGATAGCCAGGACAATACCAGG + Intronic
1178555226 21:33584684-33584706 GTGGTAGCCAAGACAAAGCAGGG + Exonic
1178616998 21:34143395-34143417 CTGGAAGCCATGCCACTGCCAGG - Intergenic
1181358270 22:22315369-22315391 GTGTGAACCAAGACAATGCCTGG + Intergenic
1182485811 22:30638000-30638022 GTGGTTGCCATGACAACTCAAGG - Intronic
1182642346 22:31778343-31778365 GAGGTACCCATCACCATGCCTGG - Intronic
1182947586 22:34338966-34338988 GAGTTAGCCATGACAATATCTGG - Intergenic
951609994 3:24480851-24480873 GTGGCAGCTTTCACAATGCCTGG - Intronic
952636084 3:35533842-35533864 GAGGAAGCCAAGACAATGCAGGG + Intergenic
954216628 3:49128423-49128445 GTGGTAGCACTCACAATGGCAGG - Intronic
954812582 3:53257114-53257136 GTGGTAGCCATGACAATGCCAGG + Intergenic
957334944 3:78816064-78816086 GTTGTAGAGATGACAGTGCCTGG + Intronic
959677977 3:109058160-109058182 CTGGAAGCTATGAAAATGCCTGG + Intronic
963775056 3:149430390-149430412 TTGGTAGCCATGTAAAGGCCAGG - Intergenic
965069842 3:163905820-163905842 ATGGTAGCCATTAGAATGCAGGG + Intergenic
969292917 4:6252208-6252230 GAGGTGCCCATGAGAATGCCAGG - Intergenic
969579496 4:8055968-8055990 CAGGTAGCCACCACAATGCCTGG - Intronic
971097831 4:23428124-23428146 GTGGTAGCCAGGAGTATGCTGGG - Intergenic
971339598 4:25755744-25755766 CTGGTAGCCATGAAAATTCATGG - Intronic
977557364 4:98499089-98499111 TTGGTAGCCATCTCAATTCCAGG - Intronic
980533120 4:134079865-134079887 GTGTTAGCTATGACAGTGACAGG + Intergenic
981752229 4:148103381-148103403 GTGGTAGCCTCTACCATGCCAGG - Intronic
982007365 4:151076372-151076394 GAGGCACCCATCACAATGCCTGG + Intergenic
987270581 5:16304366-16304388 GTATTCCCCATGACAATGCCTGG - Intergenic
991508341 5:67349802-67349824 GAGTTAGCAATGAGAATGCCTGG - Intergenic
994830039 5:104769565-104769587 ATGGTAGCCATAAAAATGACTGG - Intergenic
995622577 5:114042793-114042815 GTGGTAGATTTGACAGTGCCTGG + Intergenic
997689817 5:135820889-135820911 GTGGTAGCCATGCCTGAGCCTGG + Intergenic
998904851 5:146893901-146893923 GAGGTACCCATCACCATGCCCGG - Intronic
999796740 5:154995854-154995876 GTGGTCTCCATGACAAGGCAGGG + Intergenic
1001410135 5:171505548-171505570 GTGGCAGCAATGGCAAGGCCTGG - Intergenic
1001631077 5:173175813-173175835 GTGGCAGCGATGAAAATGACTGG + Intergenic
1004144736 6:13054838-13054860 GGGGTAGCCCTGGCAATGACTGG - Intronic
1006409995 6:33867711-33867733 GAGGTGGCCATGACCATGTCTGG - Intergenic
1007078596 6:39083391-39083413 AGGGTTGCCATGGCAATGCCAGG + Intronic
1016141154 6:140612600-140612622 GTGGGAGCCACCACCATGCCAGG - Intergenic
1018090023 6:160338141-160338163 GTGGGAGGCTTGAGAATGCCAGG - Intergenic
1019584619 7:1791802-1791824 GTGGGAGCCACCACCATGCCTGG - Intergenic
1025804709 7:64819790-64819812 ATGGAAGCCACCACAATGCCTGG - Intronic
1026057451 7:66996832-66996854 TGGGCAGCCATGACACTGCCAGG - Exonic
1028964475 7:96786765-96786787 CTGGTTGCCATGGCAATTCCTGG - Intergenic
1038621227 8:29144886-29144908 GGGGCAGCCATGTCAACGCCTGG - Intronic
1038643052 8:29342612-29342634 GTGGCAGCCATGGCCATGCCTGG - Intronic
1039765608 8:40625087-40625109 GTGGTAGCCATATGAAGGCCCGG + Intronic
1043131848 8:76472410-76472432 CTGGCAGCAATGACAATGCACGG + Intergenic
1043608734 8:82035164-82035186 GTAGTTCCCCTGACAATGCCAGG - Intergenic
1043856943 8:85274993-85275015 AAGGTAGCCATGAGTATGCCTGG + Intronic
1046859195 8:119071164-119071186 TTAGTACCCAAGACAATGCCGGG - Intronic
1048805558 8:138237966-138237988 GTGATATCCCTGACACTGCCTGG - Intronic
1048829810 8:138465131-138465153 GTGGTATCCAAGTCAATGCTGGG + Intronic
1054716896 9:68565553-68565575 ATGATAACGATGACAATGCCTGG - Intergenic
1059495031 9:114702448-114702470 CTGGTAGCCTAGACAATTCCGGG + Intergenic
1059737317 9:117115234-117115256 GTGTGAGCCATCACATTGCCCGG - Intronic
1060119328 9:120973502-120973524 GTAGAAGCCATGCCAATGCCTGG + Intronic
1060575192 9:124685469-124685491 CTGGCAGACATCACAATGCCGGG + Intronic
1062421714 9:136485570-136485592 GTGGTGGCCATCACTATTCCTGG + Exonic
1189267870 X:39730404-39730426 GGGGCTGCGATGACAATGCCAGG + Intergenic
1192205127 X:69090564-69090586 GTAGAAGGCATGAAAATGCCTGG - Intergenic
1195804026 X:108742768-108742790 GTAGTAGCCAGGACAATGGGTGG - Intergenic
1199661816 X:150058349-150058371 CTGGTGGCCAGGACAATGTCAGG - Intergenic
1201781580 Y:17729169-17729191 TTGGTAGCTGTGACAATGCGTGG + Intergenic
1201819973 Y:18176821-18176843 TTGGTAGCTGTGACAATGCGTGG - Intergenic
1202173068 Y:22071963-22071985 TTGGTAGCTGTGACAATGCGTGG + Exonic
1202218292 Y:22514408-22514430 TTGGTAGCTGTGACAATGCGTGG - Exonic
1202324894 Y:23681647-23681669 TTGGTAGCTGTGACAATGCGTGG + Intergenic
1202545877 Y:25988407-25988429 TTGGTAGCTGTGACAATGCGTGG - Intergenic