ID: 954815634

View in Genome Browser
Species Human (GRCh38)
Location 3:53278307-53278329
Sequence CAGTCTACCCATATGAGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954815631_954815634 -7 Left 954815631 3:53278291-53278313 CCTGAGAGTTCTTTAGCAGTCTA No data
Right 954815634 3:53278307-53278329 CAGTCTACCCATATGAGGCCGGG No data
954815630_954815634 -4 Left 954815630 3:53278288-53278310 CCACCTGAGAGTTCTTTAGCAGT No data
Right 954815634 3:53278307-53278329 CAGTCTACCCATATGAGGCCGGG No data
954815629_954815634 0 Left 954815629 3:53278284-53278306 CCTGCCACCTGAGAGTTCTTTAG No data
Right 954815634 3:53278307-53278329 CAGTCTACCCATATGAGGCCGGG No data
954815628_954815634 1 Left 954815628 3:53278283-53278305 CCCTGCCACCTGAGAGTTCTTTA No data
Right 954815634 3:53278307-53278329 CAGTCTACCCATATGAGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954815634 Original CRISPR CAGTCTACCCATATGAGGCC GGG Intergenic
No off target data available for this crispr