ID: 954816631

View in Genome Browser
Species Human (GRCh38)
Location 3:53287161-53287183
Sequence GTTTCTATGGGGTAGGCTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954816619_954816631 19 Left 954816619 3:53287119-53287141 CCTTCTACTCTGTTCAAAACTTG 0: 1
1: 0
2: 1
3: 16
4: 166
Right 954816631 3:53287161-53287183 GTTTCTATGGGGTAGGCTGGGGG 0: 1
1: 0
2: 2
3: 11
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954816631 Original CRISPR GTTTCTATGGGGTAGGCTGG GGG Exonic
900616788 1:3569125-3569147 GTCTCTAGGGTGTGGGCTGGAGG - Intronic
901544691 1:9947162-9947184 ATGTCTATGGAGTAGGCTTGAGG - Intronic
902237448 1:15066660-15066682 TTTTCCATGGGGTGGGCGGGAGG + Intronic
902820332 1:18939349-18939371 GTTTCTATGGTTTGGGCAGGGGG - Intronic
905624958 1:39483436-39483458 GTGTATCTGGGGTAGGCTTGGGG + Intronic
907492519 1:54817171-54817193 CTTACTCTGGGGTGGGCTGGTGG + Intronic
907819074 1:57949156-57949178 ATTTCCATGGGGGGGGCTGGGGG + Intronic
909084859 1:71158332-71158354 GTTTATATGGGGCAGGATAGGGG + Intergenic
910402699 1:86853255-86853277 GTTTCTATGTTGTAGTCTTGAGG + Intergenic
911759504 1:101599705-101599727 GGTTCTAAGAGGTGGGCTGGTGG + Intergenic
912814974 1:112821717-112821739 GGTTCTAAGGGGTGGGCTAGTGG + Intergenic
915658000 1:157377470-157377492 GTTTCTCTGGGGAAGAATGGGGG + Intergenic
918429615 1:184445432-184445454 TTTTTTATGGGGTTGGGTGGGGG - Intronic
920283811 1:204864831-204864853 GGTTCTCTAGGGTAGGCTGAGGG - Intronic
922981980 1:229834848-229834870 GTTTATATGGGCTAGGGTGGTGG - Intergenic
924795056 1:247287004-247287026 GTTTTTATGAGGTAGCCTAGCGG - Intergenic
1062925262 10:1311591-1311613 GTCTCTATGGAGCAGGCAGGGGG - Intronic
1065099707 10:22321195-22321217 GTTGCTGTGGGGGAGGCGGGCGG - Exonic
1067049524 10:43004829-43004851 GTTTCTATGCTGCAGTCTGGAGG - Intergenic
1069159207 10:65071461-65071483 TTTTCTTTGGGGTAGGCAGAAGG + Intergenic
1070313293 10:75289002-75289024 GTTACCATGGGGAAGGCTGGAGG + Intergenic
1070718070 10:78737012-78737034 CTTTCTATGGGCTGGGGTGGGGG - Intergenic
1070955931 10:80463672-80463694 GTTTCTATAGGCTAAGCTGCAGG + Intronic
1072097161 10:92193435-92193457 CTTTCTCTGGGGTGGGGTGGGGG - Intronic
1077118535 11:896354-896376 GTGTCTAGGGTGGAGGCTGGGGG - Intronic
1077118654 11:896822-896844 GTTTCTGTGGTGGAGGCTGGGGG - Intronic
1078774791 11:14383982-14384004 GTTGCTATTGGGAAGGCTGTGGG + Intergenic
1081567648 11:44269889-44269911 TTTTCTGTGGGGGAAGCTGGGGG + Intronic
1081789974 11:45775584-45775606 GTCTCTAGGTGGGAGGCTGGAGG - Intergenic
1083161592 11:60857779-60857801 GTGTCTGTGGGGTGGGGTGGTGG - Intergenic
1083633148 11:64105964-64105986 GTATCTGTGGGGTGGGCGGGAGG + Intronic
1084434878 11:69132951-69132973 GTTTCTAGGGGCTGGGGTGGGGG - Intergenic
1086005288 11:82029265-82029287 GGTTCTAAGAGGTGGGCTGGTGG - Intergenic
1089069672 11:115689681-115689703 GGTTCCTTGGGGTAGGCTGGGGG + Intergenic
1090107294 11:123867034-123867056 GGTTCTAAGAGGTAGGCTAGTGG + Intergenic
1092995026 12:13941523-13941545 AATTCTGTGGGGTAGGATGGAGG + Intronic
1093951352 12:25167187-25167209 GGTTCTAAGAGGTGGGCTGGTGG - Intronic
1102686576 12:114729428-114729450 GTTTCTCTGGGAGTGGCTGGAGG + Intergenic
1103320083 12:120087317-120087339 GTTTCTCTAGGGAAGGCAGGCGG + Intronic
1105393291 13:20003094-20003116 GTTTCTTTGGAGCAGGCTTGTGG - Exonic
1106735612 13:32585908-32585930 GTTTATAGGTGGTAGGCTGGCGG - Intergenic
1110650188 13:77934785-77934807 GGTTCTAAGAGGCAGGCTGGTGG + Intergenic
1111519179 13:89377793-89377815 GGTTCTATCAGGTAAGCTGGAGG - Intergenic
1111924773 13:94451062-94451084 GTTTCTATGGACTAGGCTGGGGG - Intronic
1112494317 13:99893596-99893618 GCTTCTTTGGATTAGGCTGGAGG - Exonic
1113365195 13:109669273-109669295 CTTGCTCTGGGGTAGGGTGGGGG + Intergenic
1113467552 13:110522997-110523019 CTCTCTGTGGGGTAGGGTGGGGG - Intergenic
1113661565 13:112109718-112109740 CTTTCAATGGGGCAGGTTGGGGG + Intergenic
1114302163 14:21388015-21388037 GTTGATATGGGAAAGGCTGGTGG - Intronic
1114365790 14:22026023-22026045 GTCTCTATGGGGAAGCCTTGTGG + Intergenic
1115444417 14:33472773-33472795 GTGTATATGGGGTGGGGTGGAGG + Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1118806962 14:69246205-69246227 GTGGGGATGGGGTAGGCTGGGGG + Intergenic
1119569255 14:75655544-75655566 GTTTCTTTGGTGTTTGCTGGGGG + Intronic
1120178701 14:81321860-81321882 GTTTCCATGGGATGGGATGGGGG - Intronic
1125523833 15:40363431-40363453 GTCTCCATGAGGTAGGCTGAGGG + Intronic
1125978523 15:43977986-43978008 GTTTCTATGGGGAGGGGTTGGGG - Intronic
1127068743 15:55267455-55267477 GGTCCTGTGGTGTAGGCTGGGGG - Intronic
1128777863 15:70337459-70337481 GTTTTTATCAGGAAGGCTGGCGG + Intergenic
1129520485 15:76183026-76183048 GTTGCAATGGGGCAGGGTGGAGG + Intronic
1129709133 15:77811369-77811391 GTTCCTCTGGCTTAGGCTGGAGG - Intronic
1129801781 15:78420451-78420473 GTATCTATGGTGTTGGCAGGAGG - Intergenic
1130605668 15:85314317-85314339 ATTCCTATGGGGTAGGATGTGGG + Intergenic
1131441251 15:92461281-92461303 TTTTCTATGGGGTGGGGTAGAGG - Intronic
1131685020 15:94758728-94758750 GGTTCTAAGAGGTGGGCTGGTGG - Intergenic
1134351442 16:13441498-13441520 TGTTCCATGGGATAGGCTGGGGG - Intergenic
1136608719 16:31353510-31353532 GGGTCTTTGGGGTGGGCTGGTGG - Intergenic
1136710479 16:32233331-32233353 GGCTCTGTGGGGCAGGCTGGGGG + Intergenic
1136757432 16:32696080-32696102 GGCTCTGTGGGGCAGGCTGGGGG - Intergenic
1136810675 16:33174295-33174317 GGCTCTGTGGGGCAGGCTGGGGG + Intergenic
1136817151 16:33284375-33284397 GGCTCTGTGGGGCAGGCTGGGGG + Intronic
1136823715 16:33340906-33340928 GGCTCTGTGGGGCAGGCTGGGGG + Intergenic
1139491641 16:67289102-67289124 GTTTCCATGCTGTAGGCTGGTGG + Exonic
1142362872 16:89635621-89635643 TTTTCTGTGGAGGAGGCTGGGGG - Intronic
1203059581 16_KI270728v1_random:956429-956451 GGCTCTGTGGGGCAGGCTGGGGG - Intergenic
1147861926 17:43528789-43528811 CTTTGTATGGGGTAAGGTGGGGG + Intronic
1151103029 17:71577433-71577455 GTTTCTTTGGGCCAAGCTGGAGG + Intergenic
1152376309 17:79920520-79920542 GTCCCTCTGGGGTCGGCTGGGGG + Intergenic
1153346349 18:4030504-4030526 GATTCCATGGGATGGGCTGGAGG - Intronic
1153715193 18:7840052-7840074 GTGTGTATGGGGTGGGGTGGGGG + Intronic
1154403341 18:14064064-14064086 GTCTCCATGGGGTGGGGTGGGGG - Intronic
1155816209 18:30314607-30314629 GGTTTTATAGGGTAGGCTGTAGG + Intergenic
1156961462 18:43036553-43036575 GTTTTTGCGGGGCAGGCTGGCGG - Intronic
1158900543 18:61957949-61957971 GCTGCTCTGGGGTGGGCTGGGGG - Intergenic
1159248168 18:65837319-65837341 GTTTTTATGAGCTAGGATGGAGG + Intronic
1165195428 19:34098930-34098952 TTTTCTATGGACTAGGGTGGGGG - Intergenic
1165418673 19:35711529-35711551 GTGTCAATGGGTGAGGCTGGTGG - Intronic
1166295170 19:41885392-41885414 GTTTCTGAAGGGTAGGGTGGGGG + Intronic
1166635774 19:44450782-44450804 GTTTGTATGAGGTAGGATGAAGG - Intergenic
1166957422 19:46474179-46474201 GTTTCATAGGGGTATGCTGGAGG - Intergenic
926886002 2:17599407-17599429 GTTCCTATTGTGTTGGCTGGAGG + Intronic
929125118 2:38516494-38516516 GTTGCTAGGGGTTAGGGTGGAGG + Intergenic
932010793 2:67975622-67975644 GTCCCTAAGGGGCAGGCTGGGGG - Intergenic
933324915 2:80823302-80823324 GTTTCTATGGGATAGACAGTAGG + Intergenic
934229040 2:90161060-90161082 CTTTCTGTGGGGTAAGCTGCAGG - Intergenic
935633405 2:105231139-105231161 GTTACCATGGGGCAGGCAGGAGG - Intergenic
936015943 2:108959152-108959174 GTGTATATGGGGCATGCTGGTGG + Intronic
936232680 2:110717511-110717533 GTTTCTGTGGGGTGGGGTGTAGG + Intergenic
936288280 2:111198528-111198550 ATTTCTATGTTGTAGTCTGGAGG + Intergenic
937894401 2:126967627-126967649 GTTTCTATGGGTTAGGATTCTGG - Intergenic
938095223 2:128457098-128457120 GTTTATGTGGGGTGGCCTGGTGG - Intergenic
938378022 2:130821286-130821308 GTTTCTAGGGGCTGGGGTGGGGG - Intergenic
941394836 2:164961496-164961518 CTACCTATGGGGTAGGATGGGGG + Intergenic
941666670 2:168249068-168249090 AGTTCTTTGGGGTAGGGTGGAGG - Intergenic
942060075 2:172221196-172221218 AATTCTATGGCTTAGGCTGGAGG - Intergenic
942254801 2:174086056-174086078 GTATCTATGGGGTAGTCTTGTGG + Intronic
943978260 2:194511052-194511074 GTTTATGTGTGGGAGGCTGGTGG - Intergenic
946305898 2:218856922-218856944 GTTTCTGTGGGGTTATCTGGAGG + Intergenic
946444542 2:219727074-219727096 GGTACTCTGGGGAAGGCTGGAGG + Intergenic
948117048 2:235501021-235501043 CTTTCCATGGGACAGGCTGGGGG + Intronic
1168739569 20:176284-176306 GGTTCTAAGAGGTGGGCTGGTGG - Intergenic
1171014775 20:21530347-21530369 GTTTACATAGGGCAGGCTGGAGG + Intergenic
1171051647 20:21865047-21865069 GTTTCTATTGCAGAGGCTGGGGG + Intergenic
1173102179 20:40097377-40097399 GTTTCTAAGAGGAAGGCTAGTGG - Intergenic
1174263747 20:49316688-49316710 GTTTCCTGGGGTTAGGCTGGAGG - Intergenic
1174714188 20:52739239-52739261 TTTTCCATGAGGTAGGCTGTTGG + Intergenic
1178972991 21:37197472-37197494 GTTTCTTTGGGTTGGGCTGTTGG + Intronic
1179130763 21:38635118-38635140 GTTTCTATGGGTTAGTGAGGAGG + Intronic
1180187528 21:46146876-46146898 GTCTCTGTGGGGTGGGGTGGGGG - Intronic
1180872027 22:19151590-19151612 GTTTCCCAGGGGTAGTCTGGAGG + Intergenic
1182043516 22:27257005-27257027 GGTTCAAAGGGGGAGGCTGGGGG - Intergenic
1182056551 22:27360120-27360142 GTTTCTATGGGGTAGGCTCAGGG - Intergenic
1182998870 22:34838364-34838386 GGTTCTAAGAGGTGGGCTGGTGG - Intergenic
1183311317 22:37111225-37111247 GTTTGTATGGTGTGGGGTGGGGG + Intergenic
1184718533 22:46295937-46295959 GTTTATTTGGGGCAGGCTGTGGG - Exonic
950416906 3:12873981-12874003 GTGACTCTGGGGAAGGCTGGTGG + Intergenic
954559309 3:51542851-51542873 GTTTGTATGGGGAAGCCAGGAGG + Intronic
954816631 3:53287161-53287183 GTTTCTATGGGGTAGGCTGGGGG + Exonic
954901992 3:54027801-54027823 GTGACTATGGGGTAGGCTTGTGG - Intergenic
955924117 3:63989168-63989190 GTTTCTGTGCAGTATGCTGGAGG + Intronic
957386903 3:79507670-79507692 GTTTCTGTGGTATATGCTGGCGG + Intronic
958881119 3:99671596-99671618 GTTACTATGGGGTAGGTGGTGGG - Intronic
959284890 3:104396251-104396273 GTTACTAGGGGGTGGGGTGGGGG - Intergenic
963002559 3:140695839-140695861 GTGGCTGTGGGGTAGGCTTGGGG - Intronic
963015280 3:140818468-140818490 GTTTATGTGTGGGAGGCTGGTGG + Intergenic
963058927 3:141209209-141209231 GGTTCTAAGAGGCAGGCTGGTGG - Intergenic
969563976 4:7966865-7966887 GTGTCCATGGGGTGGGCGGGAGG - Exonic
971321819 4:25611897-25611919 GTTTGAATGGGGTGGGGTGGGGG + Intergenic
971363615 4:25958880-25958902 GTTTCTGTGGGAAAGGCAGGAGG + Intergenic
973530953 4:51836381-51836403 TTTTCAATGGGGTAAGCTAGTGG + Intergenic
975072710 4:70162007-70162029 CTTAATATGGGGTAGGATGGTGG - Intronic
981477411 4:145200737-145200759 GTATCCATGGGGTGGGGTGGGGG + Intergenic
982366394 4:154584301-154584323 AAGTCTATGGGGGAGGCTGGTGG - Exonic
983448831 4:167886287-167886309 GTTTTCATGGGCTAGGATGGGGG + Intergenic
984088388 4:175340286-175340308 GTTTCCATGTGGTAACCTGGAGG - Intergenic
984134275 4:175916149-175916171 GTTTCTATCGGGAACCCTGGGGG - Intronic
985167462 4:187112218-187112240 GTTTGAATGGGTTAGGCTGAGGG - Intergenic
985551538 5:535718-535740 GTCTCTGTGGGGTGGGCGGGGGG - Intergenic
988333618 5:29875802-29875824 GTTTATATGATGAAGGCTGGTGG + Intergenic
989156801 5:38352118-38352140 GGTTTAATGGGCTAGGCTGGTGG - Intronic
989398692 5:40985854-40985876 GTTTGAAAGGGGTGGGCTGGAGG + Intergenic
990747919 5:58980158-58980180 GTGTCCTTGGGATAGGCTGGGGG + Intronic
994334155 5:98544790-98544812 GTGTGTGGGGGGTAGGCTGGGGG - Intergenic
994432544 5:99686097-99686119 GTTTCTATAAGGGAGTCTGGAGG - Intergenic
995124896 5:108570141-108570163 GGTTCTAAGAGGTGGGCTGGTGG + Intergenic
996313725 5:122137612-122137634 CTTACTTTGGGGTAGACTGGGGG - Intronic
997498931 5:134355963-134355985 TTTTCTATGGACCAGGCTGGGGG + Intronic
997603251 5:135154897-135154919 GTCTCTATGTGGTTGGCTGTGGG + Intronic
1000814993 5:165909703-165909725 GTGTGTAGGGGGTGGGCTGGGGG - Intergenic
1001353261 5:170994138-170994160 ATTTCTATGGAGTGGGGTGGGGG - Intronic
1001775775 5:174328101-174328123 GTTTCTGCAGGGAAGGCTGGAGG + Intergenic
1003560415 6:7175355-7175377 GTTTCAGTGGGGTGGGATGGGGG + Intronic
1004166157 6:13258244-13258266 GCTTCTAGGGGGGAGGCAGGAGG + Intronic
1010137929 6:72577059-72577081 GTTTCCAGGGGTTAGGCAGGAGG + Intergenic
1010554425 6:77261615-77261637 GTTTCTATGTTGGATGCTGGTGG - Intergenic
1011240670 6:85268136-85268158 CTCTCAATGGGGTAGGGTGGGGG + Intergenic
1013230290 6:108156604-108156626 GTTTCTTTGGGGAAGGAAGGAGG - Intronic
1014429714 6:121353791-121353813 GATTCTATGGGGCAGGGTGGCGG - Intergenic
1016271519 6:142295555-142295577 AATACTATGGGGTGGGCTGGTGG + Intergenic
1017012913 6:150075195-150075217 GTTTCTCTGGGGTAATATGGGGG + Intergenic
1017885415 6:158595761-158595783 GTTCCTCTGGGGTAGGTTAGTGG + Intronic
1019193775 6:170269289-170269311 GCTTCTGTGGGGAAGGCTGTAGG - Intergenic
1021637654 7:22707666-22707688 GGTTCTAAGGGGTGGGCTAGTGG - Intergenic
1025187173 7:56870472-56870494 GCTTCTAAGGGGTTGGGTGGGGG - Intergenic
1025684749 7:63706445-63706467 GCTTCTAAGGGGTTGGGTGGGGG + Intergenic
1026760921 7:73125121-73125143 GATAGCATGGGGTAGGCTGGTGG - Intergenic
1026828593 7:73598287-73598309 GTTAATATCTGGTAGGCTGGTGG - Intronic
1027037263 7:74933917-74933939 GATAGCATGGGGTAGGCTGGTGG - Intergenic
1027086299 7:75267535-75267557 GATAGCATGGGGTAGGCTGGTGG + Intergenic
1028086843 7:86645968-86645990 GTTTCTTTGTGGTGGGCGGGGGG + Intronic
1028341740 7:89730694-89730716 GTTTCCATGGGCTAGGCGGTTGG + Intergenic
1030435188 7:109508949-109508971 AGTTCTATGGGGTGGGGTGGAGG - Intergenic
1032847253 7:135762137-135762159 GTCCCTGTGGTGTAGGCTGGTGG - Intergenic
1037168690 8:15863030-15863052 TATTCCATGGGGTAGGGTGGAGG + Intergenic
1037362405 8:18087622-18087644 GTGTGTTTGGGATAGGCTGGTGG - Intergenic
1042433877 8:68741604-68741626 GTTAGTATGGGGTGGGGTGGAGG - Intronic
1042511592 8:69617982-69618004 GATTCCATGGGGAAGGCAGGAGG - Intronic
1043374059 8:79627781-79627803 GTTTCCAGGGGCTAGGGTGGAGG - Intronic
1044583481 8:93845997-93846019 GTTTCTATGGGCCAGGCTGAAGG + Intergenic
1045394281 8:101745030-101745052 ATTTCTGGGGGGTAGGGTGGGGG + Intronic
1045721842 8:105121491-105121513 GTTTCAATGAGGTAGGATGATGG - Intronic
1050735519 9:8758080-8758102 ATTTTGATGAGGTAGGCTGGAGG - Intronic
1051442195 9:17097318-17097340 GTTTCCAGGGGTTAGGTTGGAGG - Intergenic
1051942386 9:22523701-22523723 GATTCTATGGGGAAGCCTGATGG + Intergenic
1055347448 9:75353452-75353474 GGTTCTAAGAGGTGGGCTGGTGG + Intergenic
1056156423 9:83842919-83842941 GTTGGTAGGGGGTAGGATGGAGG - Intronic
1056354111 9:85780659-85780681 GTTGGTAGGGGGTAGGATGGAGG + Intergenic
1056982393 9:91327466-91327488 GTTTTTATGGGTTAGAATGGAGG - Intronic
1059610729 9:115890192-115890214 GTTCCTAGAGGGTAGACTGGGGG - Intergenic
1060226476 9:121794376-121794398 GGTTCTATGAGGCAGGCTAGTGG - Intergenic
1060980669 9:127789773-127789795 GTTTCCATGGGGTAGGAGGATGG + Exonic
1062026913 9:134344733-134344755 GTTGCTAAGGGGTATGGTGGTGG - Intronic
1189536279 X:41938596-41938618 GTTTATAAGGGGGAGGCAGGAGG - Intergenic
1190429662 X:50367088-50367110 GTTTAAGTGGGTTAGGCTGGTGG + Exonic
1192178799 X:68902632-68902654 GTGTCTCTGGGGGAGGATGGTGG + Intergenic
1192693580 X:73391119-73391141 GCTGCTATGGGGAAGGCTGCAGG - Intergenic
1193915008 X:87353360-87353382 GTTTCCTTGGGGAAGGATGGGGG + Intergenic
1194614699 X:96086734-96086756 GTTTCCATGGGGAAGGCTTATGG + Intergenic
1196525202 X:116722622-116722644 GGTTCTAAGAGGCAGGCTGGTGG + Intergenic
1197946332 X:131842888-131842910 GTTACTATGGGTGAGGGTGGGGG - Intergenic
1198309194 X:135413343-135413365 GTTTCTATTGGGTAGGGGGTTGG - Intergenic
1199204690 X:145135144-145135166 GCTTCTATGGGGTAGGAAGGAGG + Intergenic
1199339524 X:146660649-146660671 GTTTCTATGGGGTTCGATGTTGG - Intergenic