ID: 954816949

View in Genome Browser
Species Human (GRCh38)
Location 3:53290056-53290078
Sequence AATGGGAACCAGCTTCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954816949_954816953 -1 Left 954816949 3:53290056-53290078 CCAGTCAGAAGCTGGTTCCCATT 0: 1
1: 0
2: 0
3: 9
4: 144
Right 954816953 3:53290078-53290100 TTAAACTCCAAGACTCAAGGAGG 0: 1
1: 0
2: 2
3: 15
4: 147
954816949_954816957 16 Left 954816949 3:53290056-53290078 CCAGTCAGAAGCTGGTTCCCATT 0: 1
1: 0
2: 0
3: 9
4: 144
Right 954816957 3:53290095-53290117 AGGAGGGTACAAAGGCTCAAAGG 0: 1
1: 0
2: 0
3: 19
4: 180
954816949_954816954 0 Left 954816949 3:53290056-53290078 CCAGTCAGAAGCTGGTTCCCATT 0: 1
1: 0
2: 0
3: 9
4: 144
Right 954816954 3:53290079-53290101 TAAACTCCAAGACTCAAGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 185
954816949_954816952 -4 Left 954816949 3:53290056-53290078 CCAGTCAGAAGCTGGTTCCCATT 0: 1
1: 0
2: 0
3: 9
4: 144
Right 954816952 3:53290075-53290097 CATTTAAACTCCAAGACTCAAGG 0: 1
1: 0
2: 0
3: 16
4: 174
954816949_954816956 8 Left 954816949 3:53290056-53290078 CCAGTCAGAAGCTGGTTCCCATT 0: 1
1: 0
2: 0
3: 9
4: 144
Right 954816956 3:53290087-53290109 AAGACTCAAGGAGGGTACAAAGG 0: 1
1: 0
2: 3
3: 30
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954816949 Original CRISPR AATGGGAACCAGCTTCTGAC TGG (reversed) Intronic
901237267 1:7673881-7673903 AATAAGACCCAGCTTCTCACCGG + Intronic
903171394 1:21556640-21556662 AAAAGAAACCAGCTTCTGGCCGG + Intronic
903776486 1:25797392-25797414 ACTGGGTCCCAGCTTCTGCCTGG - Intergenic
905452486 1:38065557-38065579 AAGGTCACCCAGCTTCTGACAGG - Intergenic
906829494 1:49016382-49016404 AATAGTAACCAGCTTCTGAAGGG + Intronic
907214196 1:52848364-52848386 AATGAGAAAAAGCTTATGACGGG - Intronic
909361612 1:74766272-74766294 ACTGTAAAACAGCTTCTGACAGG + Exonic
910405307 1:86882827-86882849 AAAAGGAAGCAGATTCTGACTGG + Intronic
911300510 1:96167098-96167120 AATGGAAACCAGATTCTGGATGG - Intergenic
913319939 1:117581161-117581183 TATGGGAAACAGCTTCTGCAGGG + Intergenic
915164364 1:153940411-153940433 AATGAGACCCAGCCTCTTACTGG + Exonic
917976259 1:180240817-180240839 AATGGAATCCAGTTTCTGATGGG + Intronic
918054097 1:181003661-181003683 TAAGGAAACCAGCTTCTGTCAGG - Intronic
918382286 1:183968233-183968255 AATGGGACCCAACTTCTGTCAGG + Intronic
918500478 1:185189351-185189373 AATGTTAATCAGCTGCTGACAGG - Intronic
919516413 1:198531137-198531159 AATGAGAACCAGCAGGTGACTGG - Intronic
921972734 1:221168071-221168093 AATGAGAAACAGCTTCAGATTGG + Intergenic
1066113953 10:32223081-32223103 GATGGGACCCAGCCTCAGACAGG - Intergenic
1072460307 10:95612361-95612383 AGTGGGATCCAGCTTGTGATTGG - Intronic
1075166518 10:120072636-120072658 AAATGAAACCAGCTGCTGACAGG - Intergenic
1077537371 11:3130871-3130893 GATGGGAACCAGCAGCTGAGCGG + Intronic
1078358753 11:10652224-10652246 AATGGAACCCAGCTTGGGACAGG - Intronic
1078556357 11:12329957-12329979 AATGGAATCCATCTTCTGTCTGG - Intronic
1080650262 11:34216873-34216895 AATGGAAAGCTGCTTCTGCCCGG - Intronic
1089156588 11:116407343-116407365 AAAGTGAACCAGCTTTAGACAGG - Intergenic
1091316411 11:134617214-134617236 AAAGGGAACCAGGTGCTAACAGG + Intergenic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1092534059 12:9370895-9370917 ACTGAGAACAAGCTTCTGCCTGG - Intergenic
1092865425 12:12756632-12756654 AATGGGTACAAGCTTCTGTTTGG - Intronic
1096290537 12:50338781-50338803 AATGGGAATCAGGTTCAGAAAGG - Intronic
1097086616 12:56473462-56473484 TAGGGGGACCAGCTTCTGCCAGG - Exonic
1097507668 12:60496731-60496753 AATGGAAATCAGCATCTTACTGG - Intergenic
1107973009 13:45662277-45662299 AACAGGAACCAGCTGCTGACTGG + Intergenic
1114835839 14:26202298-26202320 AAGTGGAAACAGCTTTTGACTGG - Intergenic
1121525691 14:94617425-94617447 AATGAGAGCCAGCTTCTGGGTGG - Intronic
1127723511 15:61725717-61725739 AAGGGGAAGCAGCTTCTGCGGGG + Intergenic
1129035484 15:72646242-72646264 GATGGGAACCAGCTTGGGATGGG + Intergenic
1129214400 15:74090974-74090996 GATGGGAACCAGCTTGGGATGGG - Intergenic
1129473298 15:75766922-75766944 GATGGGAACCAGCTTGGGGCGGG - Intergenic
1131831571 15:96358147-96358169 ACATGGAACCAGCTGCTGACAGG - Intergenic
1136368356 16:29820365-29820387 AATGAGAACCAGCTGCACACGGG + Exonic
1137532262 16:49286001-49286023 AAAGGGAACCATTTTCTCACAGG + Intergenic
1138218903 16:55233034-55233056 AGTGGGAACCAGCCCCGGACAGG - Intergenic
1140488886 16:75317488-75317510 AATGGAAACTAGATTCTGCCTGG + Intronic
1141010736 16:80395995-80396017 AATGTGATGCAGCTTCTGCCTGG - Intergenic
1143854376 17:9837850-9837872 GGTGAGAACCAGCTTCTGAGAGG + Intronic
1144785908 17:17831445-17831467 TCTGGGAAGCAGCCTCTGACGGG + Intronic
1145305606 17:21673364-21673386 AATGAGAACCATCTTCTTTCAGG + Intergenic
1146590389 17:34123446-34123468 AATGGCAGCCAGCTCCTGGCAGG + Intronic
1146705234 17:34996375-34996397 ATTGGGAACCAGTTTATAACTGG + Intronic
1147252336 17:39160485-39160507 ACTGTGAACCAGATTCTCACAGG + Intronic
1150026896 17:61685660-61685682 AATGGGAACAAACTTTTGTCAGG - Intronic
1152185359 17:78852895-78852917 AATGGGAATCAGCCTCTGCAAGG - Intergenic
1152288802 17:79427197-79427219 ATTGGGATCCAGATTCTGAGTGG - Intronic
1152889628 17:82873149-82873171 AAGGGGAACCACCATCTGAGGGG - Intronic
1152946046 17:83197819-83197841 AATGGGAACAGGCTTTTGAGAGG - Intergenic
1156372653 18:36485190-36485212 AATGTGAACCAACCTCTGACTGG - Intronic
1160860832 19:1236752-1236774 CATGGGAACCAGCTTCTCCGGGG - Intronic
1161722950 19:5913851-5913873 AAAGGGCCCCAGGTTCTGACCGG - Intronic
1161774387 19:6251099-6251121 AACGGGAAACAGCTGCTTACTGG + Intronic
1166288987 19:41849724-41849746 AATGGGACCCAGACTCTGATAGG + Intronic
1167023119 19:46893509-46893531 AATGGGCACCAACTTCTGCTTGG + Intergenic
1168141881 19:54393585-54393607 GGTTGGAACCAGCCTCTGACGGG - Intergenic
925165519 2:1713512-1713534 AAGGGGCACCTGCCTCTGACAGG + Intronic
928846511 2:35680055-35680077 AATGAGAACTAGCCTGTGACAGG + Intergenic
930060639 2:47285585-47285607 AATGGGAAGCAACTGCTAACAGG - Intergenic
932063758 2:68531476-68531498 GAGAGGAACCAGCTTCTCACTGG + Intronic
932778195 2:74541388-74541410 AATATCAAACAGCTTCTGACTGG - Intronic
934795871 2:97098484-97098506 CATGGGAAGCACATTCTGACAGG - Intergenic
935882774 2:107582845-107582867 AATGTGAAAAAGCTTCTGAAGGG + Intergenic
936802367 2:116284444-116284466 AATGGGAACCAGATTTTGAAGGG + Intergenic
937233224 2:120414304-120414326 AATGGAAACCAGGTGTTGACAGG + Intergenic
937499519 2:122462809-122462831 CATGGGAACCAGATTCTGGAGGG + Intergenic
938287137 2:130128140-130128162 AATGGGAACCAGCAGTTGAGTGG - Intronic
939548260 2:143581100-143581122 ATTGGTAACCAGCTTCACACAGG + Intronic
940165307 2:150764299-150764321 AATGAGAACCACCTTCCAACTGG + Intergenic
943066206 2:183089378-183089400 AATGGGAAACAGGAGCTGACAGG - Intronic
944332334 2:198485398-198485420 AATGGGCACCTGCTTCAGGCAGG - Intronic
944446337 2:199794470-199794492 AATGGCTACCAGCCTCTGATTGG - Intronic
944947031 2:204699900-204699922 TATGGAATGCAGCTTCTGACTGG + Intronic
947234046 2:227921414-227921436 CAAGGGAACCATCTTCTAACTGG + Exonic
947610423 2:231521883-231521905 CATGGGAACCAGTGACTGACAGG + Intergenic
1169641092 20:7753391-7753413 GATGGGATCCAGCTGCTGAATGG - Intergenic
1171523123 20:25790853-25790875 AATGAGAACCACCTTCTTTCAGG + Intronic
1171530863 20:25852831-25852853 AATGAGAACCACCTTCTTTCAGG + Intronic
1171553704 20:26065030-26065052 AATGAGAACCACCTTCTTTCAGG - Intergenic
1174384530 20:50179340-50179362 ACTGGGAAACAGCTTCAGACTGG - Intergenic
1183755818 22:39763282-39763304 AATGGGAAGCAGCTTCTAAGAGG - Intronic
949672383 3:6414474-6414496 AATAGGAAACAGATTCTGAAAGG + Intergenic
952666440 3:35910125-35910147 TATGGGAGCCAGCTCCTGATTGG + Intergenic
952966824 3:38626121-38626143 CATGGGACCCAGGTCCTGACTGG - Intronic
954349654 3:50032573-50032595 AATGAGAACCAGATTCTTTCCGG + Intronic
954790661 3:53130762-53130784 AAGGGGAACAAACTTCTCACTGG + Intergenic
954816944 3:53290014-53290036 AATGGGAGCCAGCACCTGACTGG - Intronic
954816949 3:53290056-53290078 AATGGGAACCAGCTTCTGACTGG - Intronic
956897074 3:73673210-73673232 TCTGGCAACCAGCTTCTGGCTGG + Intergenic
959395104 3:105827342-105827364 TATGGGAACCAACTTCTGTGTGG - Intronic
961463265 3:127066635-127066657 AATGGGAACCAGAATATGAATGG - Intergenic
961817505 3:129558832-129558854 AATGAGAACCAGGACCTGACTGG - Intronic
962161816 3:133009062-133009084 AATTGGTACCAGTTTCTTACAGG + Intergenic
963912535 3:150826923-150826945 CATGGGAGCCAGCTGCTGAGAGG - Intergenic
967136824 3:186519621-186519643 AATAGGAACCTCCTTCTCACAGG + Intergenic
968080096 3:195839922-195839944 CAGGGGAAGCAGCTCCTGACAGG - Intergenic
974919713 4:68223859-68223881 AATGGAAAACAGCTTCTAGCAGG + Intergenic
975627767 4:76366669-76366691 AATGTGAACCAGGTTTTAACAGG + Intronic
978141889 4:105327305-105327327 ACTGGTAAGCAGTTTCTGACAGG - Intergenic
986143357 5:5052278-5052300 CATGGGCAGCAGCATCTGACCGG + Intergenic
993021347 5:82595299-82595321 TATGGCAACCAGCTTCTCGCAGG - Intergenic
996047858 5:118896124-118896146 AATGTGAAACAGCCACTGACAGG + Intronic
996567912 5:124900923-124900945 AATGGGAAGCAGCTTTTCAGTGG - Intergenic
996731163 5:126718662-126718684 GATGGCACCCAGCTTCTGTCTGG - Intergenic
997831285 5:137152726-137152748 AATGGGAACCACATTCTGGAAGG - Intronic
998672471 5:144369179-144369201 AATGGGAGCCAGGCTGTGACGGG - Intronic
1001642360 5:173253381-173253403 AATGGGCACCAGCTTTTTAAAGG + Intergenic
1008147112 6:47905329-47905351 ACTGCAAACCAGCTCCTGACTGG - Intronic
1008817195 6:55582146-55582168 GATGGGAGCCAGGTTCTAACAGG + Intergenic
1009949898 6:70383350-70383372 TATGGGAACTTGCTTCTTACAGG - Intergenic
1010381008 6:75224832-75224854 AAGGGCAGGCAGCTTCTGACAGG - Intergenic
1010564617 6:77394584-77394606 AAAAGGAACCTGCATCTGACAGG - Intergenic
1011431921 6:87296566-87296588 ATTGGGTAACAGCGTCTGACAGG + Intronic
1013781680 6:113735030-113735052 ATTGAGAACCAGCCTATGACTGG + Intergenic
1014843272 6:126244534-126244556 AAGGGAAATCAGCTTTTGACAGG + Intergenic
1017704591 6:157110503-157110525 GATGGGAACTGGATTCTGACTGG - Exonic
1021583600 7:22183804-22183826 AATGTTAACCACTTTCTGACAGG - Intronic
1023042050 7:36180717-36180739 AATTGGAACCAGCTTCCCAGAGG - Intronic
1025283554 7:57645768-57645790 AATGAGAACCATCTTCTTTCAGG + Intergenic
1033615680 7:143012014-143012036 GAAGGTAACCAGCTTCTGCCAGG - Intergenic
1035267690 7:157700702-157700724 AAAGGGAGCCAGCCTCTGATGGG - Intronic
1037960539 8:23094634-23094656 CATGGTAAGCAGCTTCTGAAAGG - Intronic
1039209945 8:35202803-35202825 AATGTGAACCAGATCCTGAAGGG - Intergenic
1041628795 8:60061628-60061650 AGGGTGACCCAGCTTCTGACAGG + Intergenic
1041874288 8:62669869-62669891 TAAGGAAACCAGCTACTGACTGG + Intronic
1042519221 8:69692834-69692856 ACTGGGAAACAGCCTCTGGCAGG - Intronic
1043777973 8:84294588-84294610 TATGAGAGCCAGCTTTTGACAGG - Intronic
1045437745 8:102181590-102181612 AATGGGATAAAGCATCTGACTGG - Intergenic
1047777471 8:128084964-128084986 GATGGGAACCTCGTTCTGACTGG - Intergenic
1047822212 8:128533546-128533568 ACTGTAAAACAGCTTCTGACAGG + Intergenic
1048099007 8:131326849-131326871 AATGGGGACCAGATGCTAACTGG - Intergenic
1050508406 9:6370424-6370446 ACTGGGGACCAGCCTATGACAGG - Intergenic
1053286919 9:36855661-36855683 CATGGGAACCAGCCCCTGAAGGG - Intronic
1053330448 9:37201586-37201608 AATGGGAAGCAAAATCTGACTGG + Intronic
1057419700 9:94901022-94901044 AATGGCAACCACCTTTTAACAGG - Intronic
1186846978 X:13540512-13540534 AAGGGGAACCAGCTGATGGCGGG + Intergenic
1187421117 X:19134526-19134548 TATGGGGACCAGCTGCTGAGAGG - Intergenic
1188808510 X:34621997-34622019 AATTGGAACCAACTTTTGATGGG + Intergenic
1190485357 X:50918141-50918163 AGTTGGAACCAGCTTTTGAAGGG - Intergenic
1192816714 X:74601221-74601243 AATGAGAATCATCTTCTAACTGG + Intronic
1192829507 X:74736437-74736459 AATAGGAAACAGCTTCTCAGAGG + Exonic
1192925053 X:75747334-75747356 AAGGGGAACCAGGTTCTTTCAGG + Intergenic
1193020157 X:76783006-76783028 AATGGGAAACAGCTTCTTGGTGG - Intergenic
1193973999 X:88094723-88094745 AATGGGAAAAAGCCTTTGACGGG + Intergenic
1194444005 X:93965601-93965623 ACAGGGAAACAGCTTCTGATGGG - Intergenic
1196400326 X:115309456-115309478 AATGCAAACCAGATTCTCACTGG - Intergenic
1196825776 X:119739181-119739203 AATGGGAACCACCTTGTGATAGG + Intergenic