ID: 954820840

View in Genome Browser
Species Human (GRCh38)
Location 3:53326179-53326201
Sequence AATGTTAATGGGATTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 297}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954820840_954820844 30 Left 954820840 3:53326179-53326201 CCTTCCACAATCCCATTAACATT 0: 1
1: 0
2: 0
3: 34
4: 297
Right 954820844 3:53326232-53326254 AATGACCATTGAACTTCTTTAGG 0: 1
1: 0
2: 0
3: 22
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954820840 Original CRISPR AATGTTAATGGGATTGTGGA AGG (reversed) Intronic
901659875 1:10792353-10792375 AAAGTAAATGGAAATGTGGAGGG + Intronic
902941322 1:19801868-19801890 AATGTTTAGGGAGTTGTGGAAGG + Intergenic
903248232 1:22032661-22032683 CATTTTAATGGAATTCTGGAAGG + Intergenic
904174307 1:28615360-28615382 TATTTTAATGGGATTAGGGAGGG - Intronic
905953272 1:41971268-41971290 AATCTTAACAGGATTGGGGAGGG + Intronic
906737817 1:48149606-48149628 AATGTTAATGGTATTTTGATAGG + Intergenic
906784714 1:48604674-48604696 AATGTAAATGGGATACTGGCGGG + Intronic
907026458 1:51124947-51124969 AATCTTAAAGGGTCTGTGGAAGG + Intronic
907132196 1:52107055-52107077 AATTTTCATGGGATTGGGAAAGG + Intergenic
907653039 1:56314328-56314350 AATGTTACTGGTGTTGTAGATGG + Intergenic
907654380 1:56327416-56327438 GATGTGAATGGGAGTGGGGATGG + Intergenic
907826572 1:58022841-58022863 AATGATGATGGGATTGTTGGCGG - Intronic
908033110 1:60022292-60022314 AAAGATAATGGTAGTGTGGATGG + Intronic
908346160 1:63235407-63235429 AATGTCATTGGGATTTTGAAAGG + Intergenic
908701220 1:66903078-66903100 AATATCACTGGGATTTTGGAGGG + Intronic
908930128 1:69307960-69307982 AATGTTAATGATAGTTTGGAGGG + Intergenic
909584716 1:77276981-77277003 AATGTTAATTGTATTGCAGAAGG + Intergenic
909633306 1:77789172-77789194 AATCTAAATGGAATTGTGGGGGG + Intronic
910036439 1:82794752-82794774 AATTATAATGAGATTGTTGAGGG - Intergenic
911021430 1:93392186-93392208 GATGTTAATGGGAGATTGGAAGG + Intergenic
913417489 1:118627281-118627303 AATGTTGATAGGAATGTGGGAGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914009588 1:143765218-143765240 AATCTTAAGGGGCTTGTAGAAGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915518687 1:156428998-156429020 TTTGTCAATGGGATTGTGGGGGG - Intronic
915984175 1:160447016-160447038 ATTGCTAATGGGATGGTGGTGGG + Intergenic
916885385 1:169062303-169062325 AATGTTAATTAGCTGGTGGATGG - Intergenic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
917242830 1:172967477-172967499 TATGTTAATGGGATGCTGGTGGG + Intergenic
917828276 1:178847684-178847706 AATGTTTTTATGATTGTGGAAGG + Intronic
918054151 1:181004306-181004328 TATGTTAATGGGATAATTGATGG + Intronic
918933260 1:190885064-190885086 CATGGTAATGGTATTGTGGGTGG + Intergenic
918936068 1:190923952-190923974 AATGTTAGTAGAAGTGTGGATGG + Intergenic
920910479 1:210212030-210212052 CATGTTAGTGAGGTTGTGGAAGG - Intergenic
921024343 1:211262793-211262815 AATATTAATGTGATTTTGCATGG + Intronic
921106288 1:211982933-211982955 ATTGATAGTGGGATTGTGGTAGG - Intronic
921170799 1:212547322-212547344 AATATTGATGGAATTGTGGAAGG + Intergenic
921197409 1:212772327-212772349 AATGTTATTGGTATTTTGGTAGG - Intronic
1064838751 10:19565189-19565211 AATGTTCATGACATTGGGGAGGG + Intronic
1065622941 10:27601739-27601761 AATGTTAAGTGGACTCTGGATGG + Intergenic
1065756289 10:28934316-28934338 AAAATTACTGGGATTCTGGAAGG + Intergenic
1068189384 10:53630588-53630610 CATGTTAACTGGATTGTGTAAGG - Intergenic
1068210868 10:53918604-53918626 AATGTCTATGGTATTGTTGAAGG + Intronic
1068836239 10:61557184-61557206 AATGTCTATGGGAATGTAGACGG + Intergenic
1069458003 10:68569112-68569134 ATTGTTAATTGGAATGTGGTAGG + Intronic
1070407311 10:76108332-76108354 AATGGAGCTGGGATTGTGGAGGG + Intronic
1070985429 10:80685918-80685940 AATGAGAATTGGATTGTGCAGGG + Intergenic
1071684306 10:87738316-87738338 ACTGTTAGTGGGATTGTAAAAGG - Intronic
1072350988 10:94556895-94556917 AAAGGTAATGGGATTGAGGGAGG - Intronic
1073711842 10:106052290-106052312 ACTGTTAGTGGGATTGTAAAAGG - Intergenic
1073715071 10:106095858-106095880 AATCTTAGTGTGATTGTGAAGGG + Intergenic
1074143009 10:110692307-110692329 AATGTTATTGGGATTTTGATAGG + Intronic
1076609658 10:131714806-131714828 AATGTTATTGGAGTTTTGGAAGG + Intergenic
1077936701 11:6795523-6795545 AAAGTACATGGGTTTGTGGAGGG + Exonic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1080411203 11:32026638-32026660 AATCTAATTGGGATTGTGGAGGG + Intronic
1081473734 11:43403372-43403394 AATGAGAATGGGACTGGGGATGG - Intronic
1081723763 11:45310531-45310553 AATGATAATGAGCTTGTGTAGGG - Intergenic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1083078794 11:60069191-60069213 AGTGCTAATGAAATTGTGGAAGG + Intronic
1084919381 11:72457007-72457029 AAATTAAATAGGATTGTGGAAGG + Intergenic
1085724209 11:78940608-78940630 AATGTTAATGGGATGGAGAATGG - Intronic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1087926137 11:103920891-103920913 AATCTTAATGAAATTGTGTAAGG - Intronic
1089013281 11:115147459-115147481 AATGTATGTGGGAGTGTGGAGGG + Intergenic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1089448595 11:118573415-118573437 AAGGTTAATGTGGTTGAGGATGG + Intronic
1089888345 11:121853739-121853761 ATTGTAAATTGGATGGTGGAAGG + Intergenic
1092309863 12:7340903-7340925 AATGGGAATGGGGTTGTGGGAGG - Intergenic
1092623596 12:10301468-10301490 AATTTTTAAAGGATTGTGGAGGG - Intergenic
1092892676 12:12983543-12983565 AATGTTAATGAGATGGTAGAAGG - Intronic
1093565783 12:20601558-20601580 AATGTTAATCAAATTGTGCATGG + Intronic
1093766980 12:22975246-22975268 AAGGTTATTGGGAGTGGGGAGGG - Intergenic
1095671000 12:44860013-44860035 AATGTTAATCTGGATGTGGAGGG - Intronic
1097243707 12:57593582-57593604 AGTGTTAATGGGATTCTGTGGGG - Intronic
1099074114 12:78083355-78083377 AATTTTAATGTGAATTTGGAGGG + Intronic
1099141878 12:78987968-78987990 AAAGGTAATGGAACTGTGGAGGG + Intronic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1099738209 12:86597787-86597809 CTTTTTAAAGGGATTGTGGATGG - Intronic
1099869181 12:88325062-88325084 GATAATAATGAGATTGTGGATGG + Intergenic
1100397724 12:94199349-94199371 AATGATAATGGAATTGGGGATGG + Intronic
1101405461 12:104424783-104424805 ACTGTTAATTGTATTGAGGATGG + Intergenic
1102256259 12:111417029-111417051 CATGTAAATGGGATTGTCTAGGG + Intronic
1104462474 12:128966710-128966732 AAAGATAATGGGAATCTGGAGGG + Intronic
1107114045 13:36727218-36727240 AATGTTTCTGTTATTGTGGAGGG - Intergenic
1107265560 13:38549468-38549490 AATGTTAATGGTATTTTGATGGG + Intergenic
1109900906 13:68768305-68768327 AAAGTTAGTGGGAATGGGGAAGG - Intergenic
1110463222 13:75770314-75770336 AATGTTGATGGGGATGTGGGTGG + Intronic
1111086671 13:83383794-83383816 AATGTTTATGGCATTATGGGTGG + Intergenic
1111270014 13:85869238-85869260 AAAGTTAATGGCATGGTGGCCGG - Intergenic
1112193949 13:97206564-97206586 AATTCTCATGGGATTGTGGGAGG - Intergenic
1113441111 13:110329301-110329323 GATGTTAGTGGGGTGGTGGAGGG - Intronic
1114951318 14:27757591-27757613 AATGTTAATGAGATTGTTCTGGG + Intergenic
1118686582 14:68297548-68297570 AATGTTCATTGGTTTGTGTAGGG + Intronic
1120020796 14:79527395-79527417 AATGATGAGGAGATTGTGGATGG + Intronic
1120927910 14:89815923-89815945 AATGTCATTGGTATTGTGGTAGG + Intronic
1120931139 14:89849522-89849544 AATGTGAGTGGGATTGTGGGAGG + Intronic
1124889568 15:33719897-33719919 CATAATAATGGGATGGTGGAAGG - Intronic
1126096003 15:45091175-45091197 GATGGTAATGGGACTGTGGATGG - Intergenic
1126220988 15:46212811-46212833 AATGTAAATGTGATAGTGGAGGG - Intergenic
1127635484 15:60865487-60865509 ATTGGTAATGGGATTGCTGATGG + Intronic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1128875657 15:71199162-71199184 AAAGGGAATGGGATTGTGGGAGG - Intronic
1130182318 15:81643138-81643160 CATTTTTATGGGATTGTGAAAGG - Intergenic
1130824267 15:87527728-87527750 AATATTAATGGGACTGTTAAGGG + Intergenic
1131337662 15:91565233-91565255 AACTGTAATGGGATGGTGGAGGG - Intergenic
1134160700 16:11886731-11886753 TATGTTAGTGGGATTAAGGATGG - Intronic
1135286431 16:21197419-21197441 AATCTTAATAAGAATGTGGAAGG + Intergenic
1137535044 16:49314413-49314435 ATTGTTACTGGGAAGGTGGAGGG - Intergenic
1137841262 16:51642976-51642998 AATGGTAATAGGATTGTGCTTGG + Intergenic
1140146537 16:72316497-72316519 AATGTGAATGGATGTGTGGATGG + Intergenic
1140603051 16:76501164-76501186 CATCTTCATGGGATTGTGTAAGG - Intronic
1141527804 16:84623656-84623678 AATGGTTATGGGATAGTGGCTGG - Intergenic
1145276486 17:21434412-21434434 CATGTTGCTGGGATTGAGGATGG - Intergenic
1146232636 17:31127295-31127317 AATGATACTGGGATTTTGAATGG + Intronic
1148888029 17:50787526-50787548 AATGAAAATGGGATGGTGGCTGG - Intergenic
1149049528 17:52288509-52288531 AAGGTTAAAGGGAAAGTGGAAGG + Intergenic
1149464262 17:56862519-56862541 AAGGGTTAAGGGATTGTGGATGG + Intronic
1150352230 17:64454424-64454446 AATGTAACTGAGACTGTGGAGGG - Intronic
1150601185 17:66652442-66652464 AATGGTCATGTGATTTTGGAGGG + Intronic
1150807515 17:68330789-68330811 AAGGCTGATGGCATTGTGGAGGG + Intronic
1151520656 17:74627019-74627041 ACTTTTAAGGGGATTGTAGAGGG + Intergenic
1152326568 17:79644910-79644932 AATTTTTATGGAAATGTGGAAGG + Intergenic
1153079987 18:1211188-1211210 AATGTTAATAGGATAGAGGAAGG - Intergenic
1154387801 18:13911340-13911362 AATGAAAATGGGACTGTGCAGGG - Intronic
1156302372 18:35846862-35846884 AATTTTAATGGGATGGTAAAGGG - Intergenic
1157046037 18:44102997-44103019 AATCTTAAAGGGATTGCAGATGG + Intergenic
1158284649 18:55866021-55866043 AATGTTAACTGCGTTGTGGAAGG - Intergenic
1158455401 18:57602446-57602468 AATGTTGGTGAGATTGTGGGAGG - Exonic
1158948173 18:62465797-62465819 AAGGTTTATGGCAATGTGGAAGG + Intergenic
1159322513 18:66871006-66871028 AATGTTTAGGGGAATGTGGCAGG + Intergenic
1160302735 18:77700406-77700428 AATGTGTATGGGGTAGTGGAGGG - Intergenic
1160367633 18:78341747-78341769 TATGTTAATTGGTTTTTGGATGG + Intergenic
1161298258 19:3530639-3530661 AAAGTGGATGGGACTGTGGATGG + Intronic
1163427618 19:17247829-17247851 AATCTTGAGGGGATTGTGAAGGG + Intronic
1164911045 19:32012229-32012251 AGTGGTAATGGGAGTGGGGAAGG - Intergenic
1165506579 19:36234988-36235010 AATTTTAATGGGGTTTTGGGAGG + Intronic
1166298166 19:41898768-41898790 AATGTGAATGCCACTGTGGAAGG + Intronic
1166413477 19:42573788-42573810 AATGACAATGGGATTGTAAATGG + Intergenic
1166431482 19:42731661-42731683 AATGTTACTGGGATTCTGTTAGG + Intronic
1166434602 19:42756874-42756896 AATGTTACTGGGATTCTGTTAGG + Intronic
1166447451 19:42870638-42870660 AATGTTACTGTGATTCTGGTAGG + Intronic
1166451917 19:42909451-42909473 AATGTTACTGGGATTCTGGTAGG + Intronic
1166454366 19:42928320-42928342 AATGTTACTGGGATGCTGGTAGG + Intronic
1166464162 19:43017645-43017667 AATGTTACTGGGATTCTAGTAGG + Intronic
1166470315 19:43074232-43074254 AATGTTACTGTGATTCTGGGAGG + Intronic
1166481445 19:43177756-43177778 AATGTTACTGGGATTCTGGTAGG + Intronic
1166483914 19:43196872-43196894 AATGTTACTGGGATTCTGGTAGG + Intronic
1166491030 19:43260739-43260761 AATGTTACTGGGATTCTGGTAGG + Intronic
1167702788 19:51060373-51060395 AATGGGACTGGGATTGTGGATGG - Intronic
925999341 2:9317712-9317734 AGTGTGAATGTGATTGTGTATGG - Intronic
928900457 2:36312396-36312418 AATGTTAATGGTAGTTTGGTGGG - Intergenic
929386043 2:41408550-41408572 CATTTTAATGGGATTTCGGAGGG - Intergenic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
930729662 2:54715874-54715896 AATGGTTATGGGGTTTTGGAGGG - Intergenic
930814420 2:55578274-55578296 AATGGGAATGGGAATGTGAAGGG + Exonic
931296023 2:60926681-60926703 AATGGTAATGCCATTATGGAAGG - Exonic
932064038 2:68534349-68534371 AGTGTTAATGGGATTGAGACAGG + Intronic
933255187 2:80072629-80072651 AATGGTATTGGAATAGTGGATGG - Intronic
933849426 2:86353624-86353646 ATTGTTGATGGGAATGTGAAAGG + Intergenic
933968232 2:87448080-87448102 AATGCTTATGGGGGTGTGGAGGG + Intergenic
934486038 2:94712107-94712129 AATGTTAATGAGATTGTTCTGGG - Intergenic
935310709 2:101780446-101780468 AAACTTATTGGGATTGAGGAAGG + Intronic
935580073 2:104749056-104749078 AATGTAAATGGGATGGAGGAAGG + Intergenic
936325565 2:111502424-111502446 AATGCTTATGGGGGTGTGGAGGG - Intergenic
937108388 2:119341013-119341035 AATGCTGATGGAATTGGGGAGGG - Intronic
937687793 2:124717748-124717770 AAAGTTAAGGGAATTGAGGATGG + Intronic
938618115 2:133020810-133020832 AATCTAAGTGGGATTGTGAAAGG + Intronic
939092222 2:137792432-137792454 AATGTTAATGTGTTTTTTGAGGG - Intergenic
939480625 2:142743082-142743104 ACTGCTGATGGGATTGTGGGAGG - Intergenic
939873642 2:147552203-147552225 AATGTGAATGGAAGTGTTGAAGG + Intergenic
940940099 2:159550138-159550160 AATGTTTATGCCATTGTGGCCGG - Intronic
941623067 2:167800415-167800437 AATGATAATGGGTGTGGGGAGGG - Intergenic
941633201 2:167906955-167906977 AATGTTAATAGGATTGTCTCCGG - Intergenic
944295781 2:198060878-198060900 AATGTTAATCGGATTGTCTCAGG + Intronic
946694199 2:222335803-222335825 AATTTTAATGGGATTTCTGAAGG + Intergenic
946896521 2:224329730-224329752 AATGTTGATGGAGTTATGGAAGG - Intergenic
947755140 2:232557354-232557376 AAGGTGAATGAGACTGTGGAAGG + Intronic
948758109 2:240170982-240171004 GCTGTTAATTGGATTGTGCAGGG + Intergenic
1169714793 20:8603348-8603370 AATGTTAACCCGATTTTGGATGG - Intronic
1170496449 20:16929757-16929779 ATTGTGAAGGGGATTGTGAAGGG + Intergenic
1173596457 20:44261702-44261724 AAGGTTAATGGAGTTGTGAATGG + Intronic
1173909996 20:46660749-46660771 AATGTTACTGGAATTCTAGAAGG - Intronic
1175702744 20:61152216-61152238 AATGTTGATAGGAATATGGATGG - Intergenic
1179470223 21:41605453-41605475 ATTGTGAATGGGAGTCTGGAAGG - Intergenic
1180964801 22:19782191-19782213 AATGTCATTGGGATTTTTGAAGG + Intronic
1183279745 22:36925642-36925664 AATGTTAAAGGCATTGAGGGAGG - Intronic
949366220 3:3284274-3284296 CATGTAATTGGGATAGTGGAAGG - Intergenic
949413354 3:3789194-3789216 CATGATACTGGGATAGTGGAAGG - Intronic
949654522 3:6201611-6201633 AATATTTATGGGATTGATGAAGG - Intergenic
949833023 3:8236795-8236817 GATGTTAATGGGAAACTGGATGG + Intergenic
951401745 3:22240986-22241008 ACTGTGCATGGGATTGTGGAAGG - Intronic
952594934 3:35005789-35005811 ACTTTTAAGGGGATTGTGGAGGG + Intergenic
953111893 3:39950322-39950344 AATGATAATGTAATTGTGAATGG - Intronic
953294407 3:41699033-41699055 ACTGTTGATGGGAATTTGGATGG + Intronic
953966886 3:47315063-47315085 TATTTTAATGGGGTTATGGAGGG - Intronic
954820840 3:53326179-53326201 AATGTTAATGGGATTGTGGAAGG - Intronic
957806894 3:85159369-85159391 GATTTTAAGGGAATTGTGGAAGG + Intronic
958875465 3:99611333-99611355 AATGTTATTGGGAATGTGATAGG + Intergenic
958937641 3:100274053-100274075 CATGGTAATGGAATTGTGGTTGG + Intronic
962403704 3:135082554-135082576 AGTGCTAAGGGGATTCTGGAAGG + Intronic
962590574 3:136885788-136885810 AAGGTTAAGGGGTTTGTAGAGGG + Intronic
962638457 3:137356685-137356707 AATGTTACTGGGATTTTGACAGG + Intergenic
963406851 3:144876227-144876249 AATGTTATTGGTATTTTGGTAGG + Intergenic
963547685 3:146682049-146682071 AATGTTTATGAGATTGTAGAAGG - Intergenic
965035863 3:163437038-163437060 AATGTTATTGGTATTGTGACAGG - Intergenic
965936129 3:174115070-174115092 AATGGTCCTGGGATTGTGGACGG + Intronic
965949052 3:174281264-174281286 AATGTGAATGGGGGTGGGGATGG - Exonic
966199462 3:177346752-177346774 ATTGTTAATTATATTGTGGAGGG - Intergenic
966870748 3:184289248-184289270 AAAGGTACTGGGATTGTGGCTGG - Intronic
967440134 3:189497944-189497966 TGTGTAAATGGGAGTGTGGAGGG + Intergenic
969209447 4:5675631-5675653 AATTTTAATGGGACTTTAGAGGG - Intronic
972089379 4:35260860-35260882 AGTGTGAAAGGGACTGTGGAAGG - Intergenic
972714141 4:41629187-41629209 AATGGTAATGAGATTTTGGTTGG - Intronic
973913987 4:55614235-55614257 AATGATAATGGTTATGTGGAAGG - Intronic
974825755 4:67127535-67127557 CATTTTAATGGGATTTTGGGAGG - Intergenic
974842563 4:67315009-67315031 AATGTCAATAGCATTGAGGATGG + Intergenic
975144417 4:70951994-70952016 GTTGTTAATGGGATTGTAAAAGG + Intronic
975571858 4:75826030-75826052 AATTTTAATTTGATTATGGAGGG - Intergenic
976665805 4:87589807-87589829 ATTTTTAAAGAGATTGTGGAAGG - Intergenic
976946370 4:90773755-90773777 AATGTTATTGTAATTTTGGATGG - Intronic
976961327 4:90979694-90979716 AATATCAAAGTGATTGTGGAAGG + Intronic
977536848 4:98263296-98263318 AATGTTAAATGGATTGTTTAAGG - Intronic
979213416 4:118133484-118133506 AATGAAAATGGCATTGAGGAGGG - Intronic
979636827 4:122964687-122964709 AAAGGTAATGGCACTGTGGAAGG - Intronic
982551605 4:156808252-156808274 AATGTGAATGGCATTGTGCTAGG + Intronic
982886545 4:160789199-160789221 AATGTTAATAGGATTGGGATTGG - Intergenic
983136865 4:164094960-164094982 ACTGTTAATGGGTTTTTGGATGG - Intronic
983923747 4:173373187-173373209 ACTGTTAAAAGGATGGTGGATGG - Intronic
984833445 4:183997688-183997710 ATTGCTGATGGGATTGGGGATGG + Intronic
987163070 5:15165233-15165255 AATGTTAATGGGAATGTAAAGGG + Intergenic
987170027 5:15245420-15245442 ATTTTTAATGGAATTTTGGAAGG + Intergenic
987225471 5:15836017-15836039 AATGTTATTGGGAAGGAGGAGGG - Intronic
987428536 5:17802174-17802196 AATGTTAATGGAATAGATGATGG - Intergenic
987489238 5:18555518-18555540 ACTGTGAATGGCATTGTGGATGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989683092 5:44052520-44052542 AATGTGAATTGAATAGTGGATGG + Intergenic
992025721 5:72666930-72666952 TATGTTACCGGGAGTGTGGAAGG + Intergenic
992578695 5:78148506-78148528 AATGTTAAAGGTTTTGTGGGAGG - Intronic
993304487 5:86258005-86258027 ACTGTTGATGGGATTGTAAATGG + Intergenic
993572279 5:89556241-89556263 AAAGGTGATGGGATGGTGGAGGG + Intergenic
994300871 5:98145954-98145976 AATGTTGAGGGCATTGTGAAAGG + Intergenic
996426894 5:123322486-123322508 AATGTTATTGGGATTTTGATAGG + Intergenic
996640540 5:125746624-125746646 TATGTCAATGGGATTGGAGAAGG + Intergenic
996969881 5:129353101-129353123 AATGTTATTGGCATTTTGGTAGG - Intergenic
997167892 5:131681222-131681244 AATCTTCATGGGATTGTGGGGGG + Intronic
998705532 5:144755353-144755375 AATGTGAATGGAAATGTGAATGG - Intergenic
1000632245 5:163604055-163604077 AATATGAAGGGGATTGAGGAGGG + Intergenic
1001991136 5:176116325-176116347 AATGTTAATGGCCTGGTGCAGGG + Intronic
1002857835 6:1054056-1054078 AATGTTGATGGCAATGTTGATGG - Intergenic
1003617464 6:7668573-7668595 TATGAGAATGTGATTGTGGATGG + Intergenic
1004198804 6:13529336-13529358 AACTTGAATGGGATTGAGGAGGG + Intergenic
1004407650 6:15349335-15349357 AATGTTGTTGTGGTTGTGGATGG - Intronic
1004895515 6:20144075-20144097 ACTGCTAATGGGATTGAGGCTGG - Intronic
1005143479 6:22661393-22661415 CATATTAATGGCATTGTGGCAGG + Intergenic
1005231261 6:23704214-23704236 AATGTTGTTGGGATTATGGCTGG + Intergenic
1009438954 6:63653098-63653120 AATGTTACTGGTATTTTGGTAGG + Intronic
1009524448 6:64726296-64726318 CATGTAAATGAGATTCTGGAGGG + Intronic
1010471926 6:76238743-76238765 AATGTTATTGGGATTTTGATGGG - Intergenic
1010813366 6:80325951-80325973 AATGTAATTTGGATTCTGGATGG + Intronic
1011848834 6:91600961-91600983 AAGGTTAATTTGATTGTGAATGG + Intergenic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1012318553 6:97813201-97813223 AATGTTAATGCTTTTTTGGAAGG + Intergenic
1014214028 6:118736033-118736055 AATGTACATGGGGTTGTGGAAGG + Intergenic
1014499845 6:122172813-122172835 ATTTTTGATGGTATTGTGGATGG - Intergenic
1016924008 6:149322892-149322914 ATTGTGAATGGGATTTTTGAGGG + Intronic
1018681218 6:166267283-166267305 TATGTTAACTGGACTGTGGAAGG - Intergenic
1019972863 7:4556003-4556025 AATGTTAATGGTAGTTTGGTGGG + Intergenic
1020149382 7:5669894-5669916 AAAGTAAGTGAGATTGTGGATGG + Intronic
1021159694 7:17257425-17257447 AATGTTTATGGGATAGTAGAAGG + Intergenic
1022667062 7:32421349-32421371 AATCATCATGGCATTGTGGAAGG + Intergenic
1022811642 7:33874410-33874432 AATGTAAATGGGGTGGAGGAAGG - Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026993294 7:74600022-74600044 AATGTGAATAGGATCTTGGAGGG + Intronic
1028466856 7:91162367-91162389 AATGTTTTTGGGAATGGGGAAGG + Intronic
1029505283 7:100960171-100960193 ACTGTTAATGGGGTGGTGGGAGG - Exonic
1030681362 7:112437746-112437768 GATGGTAATGGGATTATGGATGG + Intronic
1032766615 7:135000065-135000087 AATGTTACTGGGACAGTGCAAGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1035960443 8:4130678-4130700 AATTTTAGTGGAATTTTGGAGGG + Intronic
1039295217 8:36143842-36143864 AATGTTATTGAGATGGGGGAAGG + Intergenic
1040945442 8:52880358-52880380 AATTTTAAGGGGATTGTAGTGGG + Intergenic
1041593732 8:59621605-59621627 AATGTTGGTGAGGTTGTGGAGGG - Intergenic
1042816555 8:72883654-72883676 AAAGAGAATGGGATTGGGGAGGG - Intronic
1045147872 8:99367964-99367986 ATTTTTAAAGGGATTGGGGAAGG + Intronic
1046060814 8:109137279-109137301 AATGTTAATGGTATTTTGATGGG + Intergenic
1048588903 8:135802873-135802895 ATTGTTCATGTGACTGTGGATGG - Intergenic
1050259777 9:3829006-3829028 AATGTTCATGGTAGTATGGAGGG + Intronic
1050877387 9:10655587-10655609 AATGTTAATGGTATTGTTAAAGG - Intergenic
1052053557 9:23877458-23877480 AATGATAATGGTATTTTGAAGGG + Intergenic
1052139746 9:24965767-24965789 AATATTAATGGAATTGTATAGGG + Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1053671758 9:40372219-40372241 AATGTTAATGAGATTGTTCTGGG + Intergenic
1053921571 9:42998577-42998599 AATGTTAATGAGATTGTTCTGGG + Intergenic
1054382873 9:64512263-64512285 AATGTTAATGAGATTGTTCTGGG + Intergenic
1054512860 9:66004091-66004113 AATGTTAATGAGATTGTTCTGGG - Intergenic
1055922672 9:81478152-81478174 AATGTTAATAGGAGTGTTCAGGG - Intergenic
1056868540 9:90254352-90254374 AATCTTAGTGGGAATGTGCAAGG + Intergenic
1056994096 9:91439055-91439077 AATGTTATTGGGATTTTGATAGG + Intergenic
1057503238 9:95612481-95612503 CATGGTAATGGGCTTGAGGATGG - Intergenic
1058780986 9:108335235-108335257 ATGGTTGATGGGATTGTGGGAGG - Intergenic
1059701201 9:116776671-116776693 AGAGTTAATGGGTTTGTGTAGGG + Intronic
1060098547 9:120816012-120816034 TATGTTCTTGGGATTGGGGAAGG - Intronic
1060371041 9:123071812-123071834 AGTGTTAATGGGAAAGTGAATGG + Intronic
1061706388 9:132456573-132456595 AATCTTAATGGGATTCTGCACGG - Intronic
1186213245 X:7272584-7272606 AATGTGAATTGCATTGTGAATGG - Intronic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1187030428 X:15482002-15482024 TGTGTTAATGTGATTGTGAATGG - Intronic
1187936382 X:24340204-24340226 AGTGTTGATGAGGTTGTGGAGGG + Intergenic
1189223357 X:39391817-39391839 AATGCTAAGGGGAATGTGGGTGG + Intergenic
1189569028 X:42275322-42275344 AATCTTACTGGGAGTGTAGATGG + Intergenic
1189839224 X:45054743-45054765 ACTGTTTGTGGAATTGTGGATGG + Intronic
1190314408 X:49140822-49140844 AGTCTTGATGAGATTGTGGATGG + Intergenic
1193336815 X:80299351-80299373 ATATTTAATGGGATTGGGGATGG - Intergenic
1194617355 X:96121901-96121923 AATGATAATGGTATTTTGAAGGG - Intergenic
1194689100 X:96960145-96960167 AATGTTAATGGTATTTTGATAGG + Intronic
1194730220 X:97444420-97444442 AAAGTTAATGCTATTGTGCATGG + Intronic
1195560211 X:106274657-106274679 AATGTTAGTGGAATTGGGTATGG + Intergenic
1195561751 X:106291682-106291704 AATGTTAGTGGAATTGGGTATGG - Intergenic
1196353535 X:114761392-114761414 TATGTTAATTGGAATTTGGAAGG + Intronic
1196429786 X:115611275-115611297 AATTTTGATGGGATTATGAATGG - Intronic
1196987693 X:121293004-121293026 TGTGTTTATGGGATTGGGGAGGG + Intergenic
1197094183 X:122574114-122574136 AAGGACAATGGGATTTTGGAGGG - Intergenic
1197895506 X:131309397-131309419 AAAGTCATTGGGATTGTGGTAGG - Intronic
1198880233 X:141273116-141273138 AATGTTGATGAGATAATGGAAGG + Intergenic
1198985569 X:142448750-142448772 AATCTTAGTGGGGTTGAGGAAGG - Intergenic
1199491366 X:148403825-148403847 AAAGTTAATAGGGTTGTGGCAGG - Intergenic
1199749035 X:150797531-150797553 AATGTCATTGGGATTTTGGTAGG - Intronic
1199989974 X:152981916-152981938 AATGCAAATGGGAATTTGGAGGG + Intergenic
1201489718 Y:14526286-14526308 AATGTTAAGGGGTTGGGGGATGG + Intronic