ID: 954821110

View in Genome Browser
Species Human (GRCh38)
Location 3:53328209-53328231
Sequence GCCCTTCAGGTTCAGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954821110_954821116 11 Left 954821110 3:53328209-53328231 CCAGCACACTGAACCTGAAGGGC 0: 1
1: 0
2: 0
3: 8
4: 129
Right 954821116 3:53328243-53328265 GTTTATTCTGCACACTCCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954821110 Original CRISPR GCCCTTCAGGTTCAGTGTGC TGG (reversed) Intronic
901325960 1:8365254-8365276 GCCCCTCAGGTTCAGCGTCCCGG + Intronic
903833673 1:26189470-26189492 GCTCTTCAGGGTCAGAGGGCAGG - Exonic
907676170 1:56519799-56519821 ACCCTTAAGCTTCTGTGTGCAGG + Intronic
907792644 1:57682539-57682561 GCCATTCAGGTACCTTGTGCAGG - Intronic
915882085 1:159682995-159683017 GGCCTTCAGTTTTAGTGTCCTGG - Intergenic
916421127 1:164638804-164638826 GACCTCCAGGGTCAGAGTGCCGG + Intronic
919062359 1:192649432-192649454 TCCTTTCAGGTTTATTGTGCAGG + Intronic
920060736 1:203225364-203225386 ACCCTTCAGCTCCAGTGTTCTGG - Intronic
921060126 1:211578540-211578562 GACCTTCATGTTCATGGTGCTGG - Exonic
923284931 1:232484811-232484833 GCCTTTCAGGCTCAGATTGCTGG - Intronic
1063382235 10:5592697-5592719 GCCCTTCAGGGCCACGGTGCAGG + Intergenic
1065111168 10:22441481-22441503 TCCCTTCAGATCCAGTGTTCTGG - Intronic
1065623294 10:27605838-27605860 GGCCTTGATGTTGAGTGTGCAGG + Intergenic
1065700424 10:28420024-28420046 GTCCTTCTGTTTCAGTCTGCTGG + Intergenic
1066260910 10:33728902-33728924 GGCCTTCAGGTACAGGGAGCGGG + Intergenic
1069619277 10:69826533-69826555 TGCCTTCCGGGTCAGTGTGCTGG + Intronic
1070628418 10:78067499-78067521 CCCCTCCAGCTTCAGTTTGCAGG + Intergenic
1072037294 10:91575157-91575179 GCCCTTCTGCTTCCGTGTCCTGG + Intergenic
1072826609 10:98613114-98613136 GCCCTTCAGGGTACATGTGCAGG - Intronic
1073083616 10:100874772-100874794 CCCTTTCAGCTTCAGGGTGCCGG + Intergenic
1077506127 11:2930719-2930741 GCCCTTCAGGGTCACTGTAAAGG + Intergenic
1077551394 11:3202002-3202024 GCCCTACAGGTTGAATCTGCTGG - Intergenic
1078935442 11:15945424-15945446 GCCCTTCAGCATCAGGCTGCTGG - Intergenic
1080559590 11:33450791-33450813 GCCCTTCTGGTTCTTTGTGAAGG - Intergenic
1080686775 11:34522507-34522529 GGCCTTCAGCTTCACTGTGGGGG + Intergenic
1081083264 11:38769023-38769045 CCAGTTCAGGGTCAGTGTGCTGG - Intergenic
1083653892 11:64219893-64219915 GCCCTTCAGGGTCAGCTTCCGGG - Exonic
1088788480 11:113203528-113203550 GCCCTTCCAGCTCAGTGTCCTGG + Intronic
1090028828 11:123190184-123190206 ACCATTCAGGTTCAGGGTGATGG - Intronic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1096846811 12:54411951-54411973 CCCCCACAGGGTCAGTGTGCTGG - Exonic
1099677563 12:85781965-85781987 GCTCTTCAGCTTCAGTGGCCTGG - Intergenic
1109854066 13:68106345-68106367 GCCCTTCAAGTTCCTTTTGCAGG + Intergenic
1112817362 13:103288505-103288527 GTCCTTCAGTTTCTGTGTGCTGG + Intergenic
1113050740 13:106208884-106208906 GGCCTTCAAGTACATTGTGCTGG - Intergenic
1115649771 14:35394627-35394649 ACCCTTCATGGTCAGTCTGCTGG + Intergenic
1122218217 14:100218348-100218370 GCCCAGCAGGTTCTGTGAGCAGG - Intergenic
1124434212 15:29634184-29634206 GACCCTAAGGTTCGGTGTGCAGG + Intergenic
1131427890 15:92361852-92361874 GCCCTGCAGCTTCAGGGTTCTGG - Intergenic
1137729183 16:50677403-50677425 GCCCGTCAGGTCCTGGGTGCGGG + Exonic
1137903526 16:52295196-52295218 GCCATTCAGATTCAGTGTATAGG - Intergenic
1139303567 16:65964707-65964729 GCTCTTCAGGCTCAATGTTCTGG - Intergenic
1139574472 16:67832424-67832446 GCCCTTTGGGGTCAGTGGGCTGG + Intronic
1143231844 17:5362903-5362925 GCCCTTCAGGTACATAATGCTGG + Exonic
1144856259 17:18269878-18269900 ACCTTTCAGGTTCAGACTGCAGG + Intergenic
1147023947 17:37564275-37564297 GCCCTTCAGGTCTTATGTGCAGG + Intronic
1148352294 17:46949854-46949876 AGGCTTCAGGTTCAGTGTGGAGG + Intronic
1150441712 17:65196846-65196868 GTCCTTAAGGTTAAGTGAGCAGG + Intronic
1151703918 17:75757019-75757041 GCCCTACAAGTTCAAGGTGCAGG + Exonic
1152895895 17:82911058-82911080 GCCCTCCAGGCCCAGTGTGTGGG - Intronic
1154122441 18:11662943-11662965 GCCCATCAGGGGCAGTGTGAGGG + Intergenic
1155054640 18:22172289-22172311 GCGCCTCAGGTTCGGGGTGCGGG + Intronic
1155933635 18:31731853-31731875 GCCCTTCAGTTTCAGGTTTCAGG - Intergenic
1159539373 18:69755947-69755969 CCCCTTCAGGTCCTGTGTGGTGG - Intronic
1160199281 18:76782874-76782896 GCCCCTCAGGTTCAGCCTCCTGG + Intergenic
1162453203 19:10766936-10766958 GCCCTCCTGGCTCAGGGTGCCGG + Intronic
1163153713 19:15429029-15429051 ACCCTCCAGGTGCAGTGAGCAGG - Intronic
1168321342 19:55511833-55511855 GGCCTCCAGGATCAGTGTGGGGG + Intronic
928480945 2:31683275-31683297 ACCCTTCAGCTGCAGTCTGCTGG + Intergenic
928963334 2:36952422-36952444 GTGCTTCAGGGTCACTGTGCAGG - Intronic
930959132 2:57237465-57237487 GCCCTGCAGATTCAGTTTCCAGG + Intergenic
932403339 2:71497117-71497139 GCCCTACAGATTCATCGTGCTGG + Intronic
933722968 2:85409966-85409988 GGCCTTCAGGAGCAGTGTGGTGG + Intronic
938593392 2:132762144-132762166 GCCCTGCAAGTTAAGTGTGATGG - Intronic
940004037 2:148995147-148995169 GCCCCTCTGGTTCACTGTCCAGG + Intronic
940098100 2:150001504-150001526 GCATTTCATGTCCAGTGTGCGGG + Intergenic
945212064 2:207394111-207394133 GCCAGTCAGGTTTTGTGTGCTGG + Intergenic
946068422 2:217010148-217010170 GACCTTCAGGATCAGTGTTGGGG - Intergenic
946774629 2:223124768-223124790 GTGCTTCAGGTTGAGTTTGCAGG + Intronic
948477088 2:238227201-238227223 GCCCTACAAGTACAGTGTGTGGG - Intronic
948845090 2:240679295-240679317 GCCCTGCAGGCCCAGTGTGTGGG + Intronic
948848770 2:240695584-240695606 GCCCTGCAGGCCCAGTGTGTGGG - Intronic
1170911681 20:20577524-20577546 GCCTTTCAGGCACAGTGTGTAGG - Intronic
1171405436 20:24909551-24909573 GCCCTCCTGGTTCTGTGGGCGGG + Intergenic
1171993006 20:31710857-31710879 ACCCTTCATGTTCATTGAGCAGG + Intronic
1172356391 20:34283197-34283219 CACCTTCTGGTTCAGGGTGCTGG - Intronic
1175175420 20:57108952-57108974 CCCCTTGAGGTCCAGCGTGCTGG - Intergenic
1175183048 20:57161903-57161925 GTCCCTCAGGTTCTGTGCGCAGG - Intergenic
1180214947 21:46317916-46317938 GCCCTGCAGGTGCAGAATGCAGG - Intronic
1182611395 22:31550607-31550629 GGCCTGCTGGTTCAGTGGGCTGG + Intronic
1184235858 22:43182664-43182686 ACCCTCCAGGTTAAGGGTGCAGG - Intronic
1185105781 22:48868981-48869003 ACCCTTCAAATTCAGTTTGCTGG + Intergenic
950009534 3:9713032-9713054 GCCCTTCAGCATCCCTGTGCGGG + Exonic
953126583 3:40096314-40096336 GCCCTACAGGTCCAGAGAGCCGG - Intronic
953752282 3:45618033-45618055 TCCCTTCTGGTTCCGTGTGGTGG + Intronic
954821110 3:53328209-53328231 GCCCTTCAGGTTCAGTGTGCTGG - Intronic
956604127 3:71054481-71054503 TCCTTTCAGATACAGTGTGCAGG - Intronic
963235612 3:142953039-142953061 GTTCTTCAGGTTCTGTGTGCTGG - Intronic
964457845 3:156887312-156887334 GCCCTTGAGGTGCACAGTGCAGG + Intronic
964732834 3:159885537-159885559 GTCCCTGAGGTTCTGTGTGCAGG + Intronic
971049323 4:22842867-22842889 GACCTTCTGTTTCAGAGTGCTGG - Intergenic
972352555 4:38249966-38249988 CCACTTCAGTTTCAGTGTTCTGG + Intergenic
973294901 4:48507666-48507688 GCCCTACAGTTTCACTGGGCTGG + Intronic
975489664 4:74974720-74974742 GCCCTTAAGCTTCAATGTGATGG + Intronic
982705716 4:158706760-158706782 TCCCTTAAGGTTAAGTGTGCCGG - Exonic
985144903 4:186886477-186886499 GCCCAGCAGGTTCAAGGTGCAGG + Intergenic
986013788 5:3740377-3740399 GACCTTCAGGTTCACTGGGCAGG + Intergenic
986702566 5:10425302-10425324 TCCCTTCAGGATCAGAGTGCAGG + Intronic
990949002 5:61277930-61277952 GGCCTTCAGGTGCAGGGCGCTGG - Intergenic
993827860 5:92714711-92714733 GCCCCTGAGGCTCAGAGTGCTGG + Intergenic
997454411 5:134006266-134006288 GCCCACCAGTCTCAGTGTGCGGG - Intergenic
998561564 5:143177115-143177137 GCCTTTCTGCTTCAATGTGCTGG + Intronic
999242692 5:150136871-150136893 GCCCTTCAGCTTTAGTTTTCAGG - Intronic
1001451008 5:171824367-171824389 GCTCTTCAGGTTCTCTGTGTGGG - Intergenic
1003674802 6:8193180-8193202 GCCTTTCAGGTTCAGTTTGGAGG - Intergenic
1004118027 6:12790286-12790308 GCCCATCAGGGTAAGTGAGCAGG - Intronic
1012550220 6:100458488-100458510 GCCCTTCAGGGACAGTGGCCGGG + Intronic
1015274669 6:131371968-131371990 GGAATTCAGGTTCTGTGTGCAGG + Intergenic
1025034365 7:55584175-55584197 ATCCTTCAGGTGCATTGTGCTGG - Intergenic
1026934686 7:74247060-74247082 GCCTCCCAGGTTCAGTGAGCCGG + Intronic
1031498116 7:122477141-122477163 GGCATTCAGTTTCAGTTTGCTGG + Intronic
1031658427 7:124388436-124388458 GACATTCAGGTTCAGGATGCTGG - Intergenic
1033369541 7:140696126-140696148 GCGCATCAGGTACAGTGTGGAGG + Intronic
1035298067 7:157878039-157878061 GCCCTTCAGAGTCAGAGAGCCGG - Intronic
1038680096 8:29658791-29658813 GCCCTTCAGGTTCATGGAGGGGG - Intergenic
1039752615 8:40492232-40492254 GCCCTGCAGATTCAGTCTCCTGG - Intergenic
1039878273 8:41606154-41606176 CTTCTTCAGGTTCAATGTGCTGG - Intronic
1048188422 8:132265418-132265440 TCCCTTGCGGTTTAGTGTGCTGG - Intronic
1049194138 8:141306422-141306444 GCCCTGCAGGTTCCGGGTGGAGG - Intronic
1049289939 8:141796524-141796546 GCCCAGCTGGTCCAGTGTGCAGG + Intergenic
1049847667 8:144810954-144810976 GCCCGCCAGGTTGAGTGGGCAGG + Intronic
1050622214 9:7466111-7466133 GCACTTCATGTTCTGTGTGATGG - Intergenic
1051602574 9:18889823-18889845 GCCCTTCAGTAGCACTGTGCAGG + Intronic
1051669650 9:19496558-19496580 GCCCTTCAGGTACAGCCTGTTGG + Intergenic
1052270227 9:26620827-26620849 GCCCTGAAGGGTCAGTGTGATGG + Intergenic
1055834620 9:80424008-80424030 AACTTTCAAGTTCAGTGTGCTGG - Intergenic
1055945175 9:81687389-81687411 GCCCTTCAAGTTCACTATCCCGG - Exonic
1056772613 9:89490957-89490979 GGCCTGCAGGTCAAGTGTGCTGG - Intronic
1057930539 9:99189395-99189417 GCCATTCATGGGCAGTGTGCTGG - Intergenic
1059763027 9:117357118-117357140 ACCCATCAGGTACAGTGTCCAGG + Intronic
1061921555 9:133785266-133785288 GCCCTCCAGGGTCCGTGTTCCGG + Intronic
1061994050 9:134175162-134175184 GCCATTCAGGTTCTGGGAGCTGG + Intergenic
1062291549 9:135797489-135797511 ACCCTTCATGTTCAGTGGCCAGG - Intergenic
1062452983 9:136623290-136623312 GCCCCTCAGGGTCAGGGTTCAGG + Intergenic
1186777161 X:12876537-12876559 GCCTTTCAACTTCAGTGTGAGGG + Intronic
1191830346 X:65408130-65408152 GCCCTTCAAGTTCAGTATCGCGG + Intronic
1191959150 X:66680345-66680367 GCCCTTCAGGAGCACTGGGCTGG - Intergenic
1194206584 X:91018414-91018436 GAGCTTCAGGTTCAGTGTGGTGG + Intergenic