ID: 954822927

View in Genome Browser
Species Human (GRCh38)
Location 3:53347317-53347339
Sequence GTCTCTTAAAGGGGCCGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 1, 2: 4, 3: 4, 4: 38}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954822927_954822941 13 Left 954822927 3:53347317-53347339 CCCGCGCGGCCCCTTTAAGAGAC 0: 1
1: 1
2: 4
3: 4
4: 38
Right 954822941 3:53347353-53347375 TGGCCGTCCTCAGGGCCAGGCGG 0: 1
1: 0
2: 2
3: 40
4: 328
954822927_954822938 5 Left 954822927 3:53347317-53347339 CCCGCGCGGCCCCTTTAAGAGAC 0: 1
1: 1
2: 4
3: 4
4: 38
Right 954822938 3:53347345-53347367 CGGCCGGGTGGCCGTCCTCAGGG 0: 1
1: 0
2: 1
3: 5
4: 57
954822927_954822935 -10 Left 954822927 3:53347317-53347339 CCCGCGCGGCCCCTTTAAGAGAC 0: 1
1: 1
2: 4
3: 4
4: 38
Right 954822935 3:53347330-53347352 TTTAAGAGACGGCAGCGGCCGGG 0: 1
1: 0
2: 0
3: 18
4: 142
954822927_954822940 10 Left 954822927 3:53347317-53347339 CCCGCGCGGCCCCTTTAAGAGAC 0: 1
1: 1
2: 4
3: 4
4: 38
Right 954822940 3:53347350-53347372 GGGTGGCCGTCCTCAGGGCCAGG 0: 1
1: 0
2: 4
3: 29
4: 221
954822927_954822936 -7 Left 954822927 3:53347317-53347339 CCCGCGCGGCCCCTTTAAGAGAC 0: 1
1: 1
2: 4
3: 4
4: 38
Right 954822936 3:53347333-53347355 AAGAGACGGCAGCGGCCGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 194
954822927_954822944 27 Left 954822927 3:53347317-53347339 CCCGCGCGGCCCCTTTAAGAGAC 0: 1
1: 1
2: 4
3: 4
4: 38
Right 954822944 3:53347367-53347389 GCCAGGCGGCACTCACCCACTGG 0: 1
1: 0
2: 1
3: 9
4: 106
954822927_954822937 4 Left 954822927 3:53347317-53347339 CCCGCGCGGCCCCTTTAAGAGAC 0: 1
1: 1
2: 4
3: 4
4: 38
Right 954822937 3:53347344-53347366 GCGGCCGGGTGGCCGTCCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954822927 Original CRISPR GTCTCTTAAAGGGGCCGCGC GGG (reversed) Intronic
907329430 1:53661544-53661566 ATCTCTTAAAGGGGAGGCGTGGG + Intronic
908809297 1:67962964-67962986 GTCTCTGAAGGGGGCCTGGCAGG + Intergenic
922344180 1:224682395-224682417 GTCTCTTAAAGAGGCAACACAGG - Intronic
1072881867 10:99236112-99236134 ATCTCTTAAAGGGGCGGTGCCGG - Intergenic
1089021467 11:115219716-115219738 GTCTCTGAAAGGGGGTGCCCAGG - Intronic
1089784142 11:120895934-120895956 GTCTCTTAAAGGGACCAGCCAGG - Intronic
1098160854 12:67647926-67647948 GTCTCTCCCAGTGGCCGCGCAGG + Intergenic
1105857181 13:24384757-24384779 GACTCTGCAAGGGGCCGAGCTGG - Intergenic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1121342971 14:93115961-93115983 GCCTCTTAAAGGCGCCGCGCCGG + Intronic
1122602780 14:102929733-102929755 GTCTGGTAATGGGGCCGCGCGGG + Exonic
1132570445 16:641853-641875 GGCCCTTAAAGGGCCCGCACGGG - Exonic
1136353351 16:29726933-29726955 ATCTCTTAAAAAGGCCGGGCAGG - Intergenic
1138460381 16:57144234-57144256 GTCTCTTAAAGGCACAGTGCTGG + Intronic
1142672926 17:1495720-1495742 GTCTCTTCAGGGGGCCAGGCTGG + Exonic
1143373437 17:6454334-6454356 GGCTCTTAAAGGAGCCTCTCTGG - Exonic
1143876729 17:9997224-9997246 ATATTTTAAAGGGGCCGGGCGGG + Intronic
1144489908 17:15699869-15699891 GTTTGTTAAAGGGGCCTCGAGGG + Exonic
1144911054 17:18682090-18682112 GTTTGTTAAAGGGGCCTCGAGGG - Intronic
1145243650 17:21253533-21253555 ACCTCTTAAAGGGGCCGCGCCGG + Intergenic
1156502631 18:37569117-37569139 GTCTCTTAAAGGTGCAGATCTGG + Intergenic
1160791020 19:923815-923837 TTCCCCCAAAGGGGCCGCGCAGG - Intergenic
1163507936 19:17719436-17719458 GCCTCTTAAAGGGGCCGCACCGG - Exonic
1163712363 19:18854316-18854338 GTCTCTGAAAGGGGCCTAGATGG + Intronic
1163783581 19:19262876-19262898 GTGTATTAAAGGGGCCGCGGGGG + Intergenic
925552736 2:5093870-5093892 GTCTCTTAATGCGCCCGCTCAGG - Intergenic
934052027 2:88219200-88219222 GCCTCTTAGAGGGGCCGCAGGGG + Intergenic
936265063 2:110998439-110998461 TTCACTTAAAGGAGCCGCACTGG - Intronic
1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG + Intronic
1176871203 21:14084407-14084429 GTCTTTCCAAGGTGCCGCGCGGG - Intergenic
1179488992 21:41728186-41728208 GACTCCTAAAGGGGCCGGGGAGG - Intergenic
1181940464 22:26471776-26471798 GGCTCTTAATGGGGCAGCACAGG + Intronic
1183607158 22:38872431-38872453 GGCTCTTAAAGGGGCCGCGCGGG + Intergenic
1184690682 22:46115970-46115992 GTCTCTCAAAGGGCCCACTCTGG - Intergenic
954822927 3:53347317-53347339 GTCTCTTAAAGGGGCCGCGCGGG - Intronic
955007590 3:54984058-54984080 TTCTGTTAAAGGGGCCCCTCAGG - Intronic
956179200 3:66501341-66501363 GCCTCTTAAAGGAGACACGCAGG + Intergenic
962715109 3:138118985-138119007 GTCTGTGAAAGGGGCTGAGCTGG - Intergenic
969212042 4:5695455-5695477 GTCACTTAAAAGGTCCGGGCTGG + Intronic
985467603 5:12454-12476 CTCTCGCAAAGGCGCCGCGCCGG + Intergenic
989577575 5:43002684-43002706 GTAACTTAAAGGGGCGGCACTGG + Intergenic
998157597 5:139795574-139795596 CTTTCTTAAAGGGCCCGCGCGGG + Intergenic
1004501136 6:16211141-16211163 GTCTCTTAAAAGGGCTAGGCTGG - Intergenic
1059215985 9:112562594-112562616 GTCTCTTCAAAGGGCCTCGGTGG - Intronic
1188311964 X:28628207-28628229 GTCTCTTAAAGGGTAGGCTCAGG + Intronic
1193945376 X:87727692-87727714 GTCTCTTAAAGGGCCCCACCCGG - Intergenic
1198364924 X:135930547-135930569 GTCTCTTACATGGGCCTCTCAGG - Intergenic
1198518098 X:137428327-137428349 GTCTCTTCAAGGCGCAGAGCGGG - Intergenic