ID: 954827138

View in Genome Browser
Species Human (GRCh38)
Location 3:53383966-53383988
Sequence GAGTCAGGAGTAGCACTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954827136_954827138 -3 Left 954827136 3:53383946-53383968 CCTGGAGGAGGCGATGCTCTGAG No data
Right 954827138 3:53383966-53383988 GAGTCAGGAGTAGCACTACCAGG No data
954827134_954827138 -1 Left 954827134 3:53383944-53383966 CCCCTGGAGGAGGCGATGCTCTG No data
Right 954827138 3:53383966-53383988 GAGTCAGGAGTAGCACTACCAGG No data
954827133_954827138 0 Left 954827133 3:53383943-53383965 CCCCCTGGAGGAGGCGATGCTCT No data
Right 954827138 3:53383966-53383988 GAGTCAGGAGTAGCACTACCAGG No data
954827135_954827138 -2 Left 954827135 3:53383945-53383967 CCCTGGAGGAGGCGATGCTCTGA No data
Right 954827138 3:53383966-53383988 GAGTCAGGAGTAGCACTACCAGG No data
954827129_954827138 29 Left 954827129 3:53383914-53383936 CCTATGTATTGGGGCTGCTGGAA No data
Right 954827138 3:53383966-53383988 GAGTCAGGAGTAGCACTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954827138 Original CRISPR GAGTCAGGAGTAGCACTACC AGG Intergenic
No off target data available for this crispr