ID: 954827163

View in Genome Browser
Species Human (GRCh38)
Location 3:53384068-53384090
Sequence GCACCCACCATGACATCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954827163_954827168 11 Left 954827163 3:53384068-53384090 CCCAGAGATGTCATGGTGGGTGC No data
Right 954827168 3:53384102-53384124 TGACCCAACTGGTATTCTAGTGG No data
954827163_954827171 18 Left 954827163 3:53384068-53384090 CCCAGAGATGTCATGGTGGGTGC No data
Right 954827171 3:53384109-53384131 ACTGGTATTCTAGTGGCCTCAGG No data
954827163_954827167 0 Left 954827163 3:53384068-53384090 CCCAGAGATGTCATGGTGGGTGC No data
Right 954827167 3:53384091-53384113 CCATGACAAACTGACCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954827163 Original CRISPR GCACCCACCATGACATCTCT GGG (reversed) Intergenic
No off target data available for this crispr