ID: 954827167

View in Genome Browser
Species Human (GRCh38)
Location 3:53384091-53384113
Sequence CCATGACAAACTGACCCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954827164_954827167 -1 Left 954827164 3:53384069-53384091 CCAGAGATGTCATGGTGGGTGCC No data
Right 954827167 3:53384091-53384113 CCATGACAAACTGACCCAACTGG No data
954827156_954827167 15 Left 954827156 3:53384053-53384075 CCCTTTCCACCTGGACCCAGAGA No data
Right 954827167 3:53384091-53384113 CCATGACAAACTGACCCAACTGG No data
954827160_954827167 6 Left 954827160 3:53384062-53384084 CCTGGACCCAGAGATGTCATGGT No data
Right 954827167 3:53384091-53384113 CCATGACAAACTGACCCAACTGG No data
954827154_954827167 27 Left 954827154 3:53384041-53384063 CCATGGAGCTTGCCCTTTCCACC No data
Right 954827167 3:53384091-53384113 CCATGACAAACTGACCCAACTGG No data
954827157_954827167 14 Left 954827157 3:53384054-53384076 CCTTTCCACCTGGACCCAGAGAT No data
Right 954827167 3:53384091-53384113 CCATGACAAACTGACCCAACTGG No data
954827158_954827167 9 Left 954827158 3:53384059-53384081 CCACCTGGACCCAGAGATGTCAT No data
Right 954827167 3:53384091-53384113 CCATGACAAACTGACCCAACTGG No data
954827163_954827167 0 Left 954827163 3:53384068-53384090 CCCAGAGATGTCATGGTGGGTGC No data
Right 954827167 3:53384091-53384113 CCATGACAAACTGACCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954827167 Original CRISPR CCATGACAAACTGACCCAAC TGG Intergenic
No off target data available for this crispr