ID: 954827168

View in Genome Browser
Species Human (GRCh38)
Location 3:53384102-53384124
Sequence TGACCCAACTGGTATTCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954827163_954827168 11 Left 954827163 3:53384068-53384090 CCCAGAGATGTCATGGTGGGTGC No data
Right 954827168 3:53384102-53384124 TGACCCAACTGGTATTCTAGTGG No data
954827158_954827168 20 Left 954827158 3:53384059-53384081 CCACCTGGACCCAGAGATGTCAT No data
Right 954827168 3:53384102-53384124 TGACCCAACTGGTATTCTAGTGG No data
954827157_954827168 25 Left 954827157 3:53384054-53384076 CCTTTCCACCTGGACCCAGAGAT No data
Right 954827168 3:53384102-53384124 TGACCCAACTGGTATTCTAGTGG No data
954827156_954827168 26 Left 954827156 3:53384053-53384075 CCCTTTCCACCTGGACCCAGAGA No data
Right 954827168 3:53384102-53384124 TGACCCAACTGGTATTCTAGTGG No data
954827164_954827168 10 Left 954827164 3:53384069-53384091 CCAGAGATGTCATGGTGGGTGCC No data
Right 954827168 3:53384102-53384124 TGACCCAACTGGTATTCTAGTGG No data
954827160_954827168 17 Left 954827160 3:53384062-53384084 CCTGGACCCAGAGATGTCATGGT No data
Right 954827168 3:53384102-53384124 TGACCCAACTGGTATTCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954827168 Original CRISPR TGACCCAACTGGTATTCTAG TGG Intergenic
No off target data available for this crispr