ID: 954827171

View in Genome Browser
Species Human (GRCh38)
Location 3:53384109-53384131
Sequence ACTGGTATTCTAGTGGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954827164_954827171 17 Left 954827164 3:53384069-53384091 CCAGAGATGTCATGGTGGGTGCC No data
Right 954827171 3:53384109-53384131 ACTGGTATTCTAGTGGCCTCAGG No data
954827163_954827171 18 Left 954827163 3:53384068-53384090 CCCAGAGATGTCATGGTGGGTGC No data
Right 954827171 3:53384109-53384131 ACTGGTATTCTAGTGGCCTCAGG No data
954827166_954827171 -5 Left 954827166 3:53384091-53384113 CCATGACAAACTGACCCAACTGG No data
Right 954827171 3:53384109-53384131 ACTGGTATTCTAGTGGCCTCAGG No data
954827158_954827171 27 Left 954827158 3:53384059-53384081 CCACCTGGACCCAGAGATGTCAT No data
Right 954827171 3:53384109-53384131 ACTGGTATTCTAGTGGCCTCAGG No data
954827165_954827171 -4 Left 954827165 3:53384090-53384112 CCCATGACAAACTGACCCAACTG No data
Right 954827171 3:53384109-53384131 ACTGGTATTCTAGTGGCCTCAGG No data
954827160_954827171 24 Left 954827160 3:53384062-53384084 CCTGGACCCAGAGATGTCATGGT No data
Right 954827171 3:53384109-53384131 ACTGGTATTCTAGTGGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954827171 Original CRISPR ACTGGTATTCTAGTGGCCTC AGG Intergenic
No off target data available for this crispr