ID: 954830528

View in Genome Browser
Species Human (GRCh38)
Location 3:53417684-53417706
Sequence AGCCGCAGCAACAAAGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954830528_954830531 -9 Left 954830528 3:53417684-53417706 CCACAGCCTTTGTTGCTGCGGCT No data
Right 954830531 3:53417698-53417720 GCTGCGGCTGCAGCTGGTTCTGG No data
954830528_954830532 -8 Left 954830528 3:53417684-53417706 CCACAGCCTTTGTTGCTGCGGCT No data
Right 954830532 3:53417699-53417721 CTGCGGCTGCAGCTGGTTCTGGG No data
954830528_954830533 -7 Left 954830528 3:53417684-53417706 CCACAGCCTTTGTTGCTGCGGCT No data
Right 954830533 3:53417700-53417722 TGCGGCTGCAGCTGGTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954830528 Original CRISPR AGCCGCAGCAACAAAGGCTG TGG (reversed) Intergenic
No off target data available for this crispr