ID: 954832302

View in Genome Browser
Species Human (GRCh38)
Location 3:53432426-53432448
Sequence TACAGTATACAGCAGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954832302_954832307 -7 Left 954832302 3:53432426-53432448 CCCTGTCCCTGCTGTATACTGTA No data
Right 954832307 3:53432442-53432464 TACTGTACTGCCTGGCACATTGG No data
954832302_954832312 23 Left 954832302 3:53432426-53432448 CCCTGTCCCTGCTGTATACTGTA No data
Right 954832312 3:53432472-53432494 AGTAAATTTTGGTTGAATGATGG No data
954832302_954832309 12 Left 954832302 3:53432426-53432448 CCCTGTCCCTGCTGTATACTGTA No data
Right 954832309 3:53432461-53432483 TTGGTGCACCCAGTAAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954832302 Original CRISPR TACAGTATACAGCAGGGACA GGG (reversed) Intergenic
No off target data available for this crispr