ID: 954834695

View in Genome Browser
Species Human (GRCh38)
Location 3:53455602-53455624
Sequence GTGGAGCTGCATAATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954834695_954834700 -6 Left 954834695 3:53455602-53455624 CCATCCTCATTATGCAGCTCCAC No data
Right 954834700 3:53455619-53455641 CTCCACTTCATGGTTCTGGAGGG No data
954834695_954834699 -7 Left 954834695 3:53455602-53455624 CCATCCTCATTATGCAGCTCCAC No data
Right 954834699 3:53455618-53455640 GCTCCACTTCATGGTTCTGGAGG No data
954834695_954834698 -10 Left 954834695 3:53455602-53455624 CCATCCTCATTATGCAGCTCCAC No data
Right 954834698 3:53455615-53455637 GCAGCTCCACTTCATGGTTCTGG No data
954834695_954834702 15 Left 954834695 3:53455602-53455624 CCATCCTCATTATGCAGCTCCAC No data
Right 954834702 3:53455640-53455662 GGCCACTCCAACTCCAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954834695 Original CRISPR GTGGAGCTGCATAATGAGGA TGG (reversed) Intergenic
No off target data available for this crispr