ID: 954841510

View in Genome Browser
Species Human (GRCh38)
Location 3:53515695-53515717
Sequence GCTCCTCAGGACCCAGGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 757
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 708}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954841503_954841510 16 Left 954841503 3:53515656-53515678 CCAAGGCTCACAGATGGGAGCTG 0: 1
1: 0
2: 4
3: 32
4: 289
Right 954841510 3:53515695-53515717 GCTCCTCAGGACCCAGGTGATGG 0: 1
1: 0
2: 1
3: 47
4: 708

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954841510 Original CRISPR GCTCCTCAGGACCCAGGTGA TGG Intronic
900025040 1:264718-264740 TCTCCTCAGGACCCACCCGAGGG - Intergenic
900106133 1:981882-981904 GCCCCTCTGGACCCAGGGGTGGG + Intronic
900570683 1:3356857-3356879 GACCCTCAGAACCCAGGTGCCGG + Intronic
900906772 1:5564783-5564805 GCTCCTCATGACACGGGTTAGGG - Intergenic
901233430 1:7653961-7653983 GCCCCTTAGGACACAGGTGCTGG + Intronic
901441716 1:9282162-9282184 GCTCCTCAGGTCCCAGGCTGAGG - Intergenic
902027578 1:13395222-13395244 GCTCCTCACATCCCAGATGATGG + Intergenic
902062529 1:13657849-13657871 GCTCCTCACGTCCCAGACGATGG - Intergenic
902884598 1:19395716-19395738 GCTTCTCTGCACACAGGTGATGG - Intronic
903458250 1:23503728-23503750 GCTCCTCACGTCCCAGACGATGG - Intergenic
903501412 1:23802036-23802058 ACTTCTCAGGACACAGGTCATGG - Exonic
903508083 1:23852935-23852957 GCTCCTCACGTCCCAGACGATGG - Intronic
903551059 1:24157557-24157579 GCTCCTCTGGTCCCAAGCGAAGG - Exonic
903921702 1:26804391-26804413 GCTCCTCACGTCCCAGACGATGG + Intergenic
903961284 1:27059284-27059306 GGTCCTCAGAACCCAAGTGCGGG + Intergenic
904656071 1:32048396-32048418 GCTACTCAGGAGGCAGGGGAAGG + Intronic
905599241 1:39235042-39235064 GCTCCTCACATCCCAGATGATGG + Intronic
905953740 1:41974911-41974933 GCCCTTCAGGACTGAGGTGAAGG + Intronic
906356061 1:45106533-45106555 GCTCCTCACATCCCAGATGATGG - Intronic
906770543 1:48479197-48479219 GCTCCTCACGTCCCAGACGATGG - Intergenic
908370124 1:63472934-63472956 GCTCCTCATATCCCAGATGATGG - Intronic
908467782 1:64414708-64414730 GCTCCTCACGTCCCAGACGATGG - Intergenic
910493604 1:87800744-87800766 TTTCCTGAGGACCCACGTGATGG - Intergenic
910803045 1:91164425-91164447 GAGCTGCAGGACCCAGGTGAAGG + Intergenic
911325929 1:96470129-96470151 GCTCCTCACGTCCCAGACGATGG + Intergenic
911569841 1:99508580-99508602 GCTCCTCACATCCCAGATGATGG - Intergenic
911721947 1:101200705-101200727 GCTCCTCAGCACCCAGGCCTAGG + Intergenic
912515886 1:110216363-110216385 GCTCCTCAGGAAGGAGGTGGAGG - Intronic
912560523 1:110548287-110548309 GCCCCTCAGGTCGCAGATGAAGG + Intergenic
912669159 1:111608437-111608459 GCTCCTCACGTCCCAGGCGATGG + Intronic
912751614 1:112293038-112293060 GCTCCTCATATCCCAGATGATGG - Intergenic
912966608 1:114242321-114242343 GCTCCTCACATCCCAGATGATGG - Intergenic
913022876 1:114804867-114804889 GCTCCTCACATCCCAGATGATGG + Intergenic
913078264 1:115359859-115359881 GCTCCTCACCTCCCAGATGAAGG + Intergenic
913078599 1:115361051-115361073 GCTCCTCACATCCCAGATGATGG + Intergenic
914392107 1:147232958-147232980 GCTCCTCATGTCCCAGACGATGG - Intronic
914468401 1:147950470-147950492 GCTCCTCACGTCCCAGACGATGG + Intronic
914893914 1:151651738-151651760 GCTCCTCACATCCCAGATGATGG + Intronic
914965886 1:152256685-152256707 GCTCCTCACGTCCCAGACGATGG + Intergenic
915602633 1:156931945-156931967 GCTCCACAGGCTCCAGGAGAGGG - Exonic
915621880 1:157091224-157091246 GCTCCTCAGGAAGGTGGTGATGG - Intergenic
915992558 1:160531981-160532003 GCTCCTCACATCCCAGATGATGG - Intergenic
916223353 1:162465862-162465884 GCTCCTCACGTCCCAGACGATGG - Intergenic
917205880 1:172571518-172571540 GCTCCTCACGTCCCAGACGATGG - Intronic
917304532 1:173613050-173613072 GCTCCTCACATCCCAGATGATGG - Intronic
917583219 1:176397139-176397161 GCTCCTCACATCCCAGATGATGG + Intergenic
918812567 1:189140149-189140171 GCTCCTCACATCCCAGATGATGG + Intergenic
921238462 1:213152776-213152798 GCTCCTCACATCCCAGATGATGG + Intronic
921478442 1:215636628-215636650 GCTCCACAGCACGCAGGGGAAGG + Intronic
921902857 1:220467054-220467076 GCTCCTCACATCCCAGATGATGG + Intergenic
922102384 1:222487458-222487480 GCTCCTCACGTCCCAGACGATGG - Intergenic
922540694 1:226417094-226417116 GCTCCTCAGGAGCCTGGGGCAGG - Intergenic
923567298 1:235085797-235085819 GCTCCTCAGACCCCAGGGGAGGG + Intergenic
923589805 1:235308934-235308956 GCTCCTCACGTCCCAGACGATGG - Intronic
923840928 1:237669825-237669847 GCTCCTCACATCCCAGATGATGG + Intronic
924139525 1:241007808-241007830 GGTCCTGAGGGCCCAGGTGAGGG + Intronic
924721539 1:246627525-246627547 CCTACTCAGGACAGAGGTGAAGG + Intronic
924797109 1:247300455-247300477 GCTGATCAGTACCAAGGTGAGGG + Exonic
1062836043 10:636454-636476 TCTCCTCTGGAGCCAGTTGAAGG + Intronic
1062982511 10:1737130-1737152 GCTCCCCAGGACCGAGGCCATGG + Exonic
1064398762 10:15003002-15003024 GAGCCTCAGGATACAGGTGATGG + Intergenic
1065271238 10:24036018-24036040 GCTCATTAGAGCCCAGGTGAAGG + Intronic
1065681567 10:28239255-28239277 GCTCCTCAGGAGCCTGGGGCAGG - Intronic
1066141153 10:32505781-32505803 GCTCCTCACATCCCAGATGATGG + Intronic
1066432232 10:35363003-35363025 GCTCCTCACTTCCCAGGTGGTGG + Intronic
1066818777 10:39456233-39456255 GCTCCTCACATCCCAGATGATGG + Intergenic
1067026388 10:42847161-42847183 GCTCCTCACGTCCCAGATGATGG - Intergenic
1067052389 10:43029369-43029391 GCTCCTCAGGGTGGAGGTGAGGG + Intergenic
1067117513 10:43446730-43446752 GCTCCTCACATCCCAGATGATGG + Intronic
1067128907 10:43543889-43543911 GCTCCTCACTTCCCAGATGATGG - Intergenic
1067128916 10:43543928-43543950 GCTCCTCACTTCCCAGATGATGG - Intergenic
1067334243 10:45347783-45347805 GCTCCTCACATCCCAGATGATGG - Intergenic
1067354393 10:45511867-45511889 GCTCCTCACGTCCCAGACGATGG - Intronic
1067847534 10:49735976-49735998 GAGCCTCAGGGCCGAGGTGAGGG + Intronic
1068673178 10:59744122-59744144 GCTCCTCACATCCCAGATGATGG - Intergenic
1069297970 10:66870887-66870909 ACTCCTCAGGACAATGGTGAGGG - Intronic
1069365574 10:67691351-67691373 GCTCCTCACATCCCAGATGATGG - Intronic
1069674590 10:70238740-70238762 GCTCCTCACCTCCCAGATGAAGG + Intergenic
1069674764 10:70239348-70239370 GCTCCTCACATCCCAGATGATGG + Intergenic
1069821132 10:71229458-71229480 GCTCCTCAGGATCCAGGGGCAGG - Intronic
1070367449 10:75750620-75750642 GCTCCTCACATCCCAGATGATGG + Intronic
1070367513 10:75750852-75750874 GCTCCTCACATCCCAGATGATGG + Intronic
1070701365 10:78603972-78603994 GCTCTTCAGGAGCCAGGTGGTGG + Intergenic
1070807591 10:79279500-79279522 GCTCCTCACATCCCAGATGATGG + Intronic
1071688386 10:87787505-87787527 GCTACTCAGGACCCAGAGGCAGG + Intronic
1072286984 10:93925643-93925665 GCCACTCAGGGCCAAGGTGAAGG + Intronic
1072291641 10:93970499-93970521 GCTCCTCACATCCCAGGCGATGG - Intergenic
1072684696 10:97529300-97529322 GCTCCTCACATCCCAGATGATGG + Intronic
1073029719 10:100515997-100516019 GCTCATGAGGAGCCAAGTGAGGG - Intronic
1074057829 10:109938589-109938611 GCTGCCAAGGAGCCAGGTGAGGG + Intergenic
1074152249 10:110767865-110767887 GCTCCTCACGTCCCAGACGATGG + Intronic
1075051074 10:119182736-119182758 GCTCCTCACATCCCAGATGATGG + Intergenic
1075181520 10:120215578-120215600 GCTCCTCACATCCCAGATGATGG + Intergenic
1075415052 10:122256502-122256524 GCTCATCAGTACCGGGGTGAGGG - Intergenic
1075842717 10:125518228-125518250 GCTCCTCATGTCCCAGACGATGG - Intergenic
1076305233 10:129461463-129461485 GCTCCTCACGATGCAGGTGAAGG - Intergenic
1076364739 10:129914608-129914630 GCTGCCCAGGGCTCAGGTGAAGG - Intronic
1076594749 10:131618750-131618772 GTTGCTCAGGAGCAAGGTGAGGG - Intergenic
1076804692 10:132849574-132849596 CTCCCTCAGGACCCTGGTGATGG - Intronic
1077104590 11:836663-836685 GCTCCCCAGGCTCCAGGTGGGGG - Intronic
1077701982 11:4450663-4450685 TCTACTCAGGACCTGGGTGAGGG + Intergenic
1077970873 11:7188503-7188525 TCTGCTCAGTACCTAGGTGATGG - Intergenic
1078122338 11:8523251-8523273 GCTCCTCACATCCCAGATGATGG - Intronic
1078686814 11:13539605-13539627 GCTCCACAGGAGCCAGGGAAGGG - Intergenic
1078830096 11:14970221-14970243 CCTCCTCAGGACCCAGGCACTGG + Intronic
1079018262 11:16887853-16887875 GCTCCTCACATCCCAGATGATGG - Intronic
1080741049 11:35064571-35064593 GCTCCCCAGGACTCACCTGAGGG + Intergenic
1080859990 11:36144388-36144410 GCTCCTCACATCCCAGATGATGG - Intronic
1080983044 11:37431065-37431087 GCTCCTCACATCCCAGATGATGG + Intergenic
1081579652 11:44343488-44343510 GCTCCAAAGGACCCAGGCCATGG - Intergenic
1081618639 11:44605375-44605397 GATCCTCATTGCCCAGGTGACGG + Exonic
1081667825 11:44926849-44926871 GCCCCTTGGGTCCCAGGTGAAGG - Intronic
1081987724 11:47318699-47318721 GCCTCACAGGAGCCAGGTGATGG - Intronic
1082233825 11:49798742-49798764 GCTCCTCACATCCCAGATGATGG + Intergenic
1082973150 11:59044298-59044320 GCTTCTCAGGAACCAGGGAAGGG + Intergenic
1082977547 11:59087864-59087886 GCTTCTCAGGAACCAGGGAAGGG + Intergenic
1083042207 11:59699506-59699528 GCTCCTCACGTCCCAGACGATGG - Intergenic
1083120725 11:60510062-60510084 GCTCCTCACATCCCAGATGATGG - Intergenic
1083130624 11:60621834-60621856 GCTCCTCACGTCCCAGATGATGG - Intergenic
1083541609 11:63515488-63515510 GCTGCTCAGCCCCCAGGGGAAGG - Intronic
1083764716 11:64836293-64836315 GCTCCTGAGGAGGCAGGGGAGGG + Exonic
1083967161 11:66049945-66049967 GCTGCCCAGCTCCCAGGTGATGG - Intergenic
1084192131 11:67504096-67504118 GCTCTACATGATCCAGGTGAGGG - Exonic
1084359361 11:68659694-68659716 GGCCCTCAGGCCCCAGGTGGTGG + Intergenic
1084972139 11:72777772-72777794 GGACCTCTGGACCCAGGTAAGGG + Intronic
1084989447 11:72909494-72909516 GCTCCTCACATCCCAGATGATGG - Intronic
1085609442 11:77933683-77933705 GCTCCTCACATCCCAGATGATGG - Intronic
1086122687 11:83317333-83317355 GCTCCTCACGTCCCAGACGATGG + Intergenic
1086365994 11:86110398-86110420 GCTCCTCACGTCCCAGACGATGG - Intergenic
1086446760 11:86878722-86878744 GCTCCTCACGTCCCAGACGATGG - Intronic
1086697178 11:89860479-89860501 GCTCCTCACATCCCAGATGATGG - Intergenic
1086708981 11:89984008-89984030 GCTCCTCACATCCCAGATGATGG + Intergenic
1086881407 11:92157346-92157368 GCTCCTCAACTCCCAGATGATGG - Intergenic
1087084201 11:94199897-94199919 GCTCCTCCTGACCCAGATGGAGG - Intergenic
1087214673 11:95482277-95482299 GCTCCTCACGTCCCAGACGATGG - Intergenic
1087669529 11:101089076-101089098 GTACCTCAGTACCTAGGTGATGG + Intronic
1088257045 11:107912264-107912286 GCTCCTCACGTCCCAGACGATGG - Intronic
1088659020 11:112027436-112027458 GCTCCTCACGTCCCAGACGATGG + Intronic
1089748975 11:120636885-120636907 GGACATCAGGACCCAGGTGGAGG - Intronic
1089872167 11:121685317-121685339 GGAGCTCAGGACCCAGGTGGAGG + Intergenic
1090386653 11:126361207-126361229 CCCTCTCAGGACCCAAGTGAGGG - Intronic
1090791247 11:130092258-130092280 GCTCCTCACATCCCAGATGATGG + Intronic
1091275367 11:134346112-134346134 GCTCCCCAGGGACCAGGGGAGGG - Intronic
1092185493 12:6475641-6475663 GCTCCTCACATCCCAGATGATGG + Intergenic
1092208829 12:6633237-6633259 CCACCTCAGGACACAGGTCAGGG - Intronic
1092433938 12:8431390-8431412 GCCCCTCAGGACTCACTTGAAGG + Intergenic
1092843751 12:12565869-12565891 GCTCCTCACGTCCCAGACGATGG - Intergenic
1094239138 12:28201564-28201586 GCTCCTCACGTCCCAGGCGATGG + Intronic
1094670432 12:32563537-32563559 GCTCCTCACGTCCCAGACGATGG + Intronic
1095068909 12:37815455-37815477 GCTCCTCACATCCCAGATGATGG + Intergenic
1095570997 12:43684829-43684851 GCTCCTCACGTCCCAGACGATGG - Intergenic
1095644389 12:44526063-44526085 GCTACTCAGGGCCCAGGTAAAGG + Intronic
1096041504 12:48520884-48520906 GCTCCTCACATCCCAGATGATGG + Intronic
1096063890 12:48724525-48724547 GCTCCTCACATCCCAGATGATGG - Intergenic
1096224272 12:49855003-49855025 GTTCCTCAAGACCCAGCTCATGG + Intergenic
1096224892 12:49860688-49860710 GCTCCTCATGTCCCAGACGATGG - Intergenic
1096482083 12:51949004-51949026 GGTCTTCAGGACCCAGCTGAAGG - Intergenic
1096660404 12:53120705-53120727 GCTCCTCAGAACCCAGATCAGGG + Intronic
1097127191 12:56784213-56784235 GCTCCTCACATCCCAGATGATGG + Intronic
1097254748 12:57665043-57665065 GCTCCTCACATCCCAGATGATGG - Intergenic
1097779485 12:63686617-63686639 GCTCCTCACATCCCAGATGATGG - Intergenic
1098375309 12:69807773-69807795 GCTCCTCACCTCCCAGATGATGG + Intronic
1098536296 12:71597269-71597291 TCTCCTCAGTACCTGGGTGATGG - Intergenic
1100892019 12:99136199-99136221 GCCTCTCAGGACCCAGGTATGGG + Intronic
1101740280 12:107495028-107495050 GCTTCTCAGCAACCAGGGGAAGG + Intronic
1101858357 12:108462917-108462939 GGTCCTCAGAACCAAGGTGGGGG + Intergenic
1102646164 12:114405350-114405372 GCTCCCCGGGACCCTGGCGAGGG - Intronic
1103189179 12:118986188-118986210 GATCATCAGGAGCCAGGTGAGGG + Intronic
1103560267 12:121789896-121789918 GCTCATCAGGGCCAAGGTGTGGG - Intronic
1103991195 12:124800497-124800519 TCTTCACAGGAGCCAGGTGAAGG + Intronic
1104277676 12:127344626-127344648 TCTTCTCAGTACCCAGGTGCAGG + Intergenic
1104479091 12:129091641-129091663 GGTCCTCAGAGCCCAGGTGAGGG - Intronic
1105210687 13:18255055-18255077 GCTCCCCAGGACCCAAGGGCAGG + Intergenic
1105250801 13:18697537-18697559 ACTCCTCAGGACACATGTGTGGG + Intergenic
1105980649 13:25513494-25513516 GCTCCTCACGTCCCAGAAGATGG + Intronic
1106000051 13:25713772-25713794 GCTCCCCAGGACCCAGAACATGG - Intronic
1106495151 13:30269530-30269552 GCTCCTCACGTCCCAGACGATGG - Intronic
1106560289 13:30840142-30840164 GCTCCTCACATCCCAGATGATGG + Intergenic
1106746730 13:32716119-32716141 GCTCCTCACGTCCCAGACGATGG - Intronic
1107588990 13:41882340-41882362 GCTCCTCACGTCCCAGACGACGG + Intronic
1107737594 13:43416032-43416054 GCTCCTCACTTCCCAGATGATGG + Intronic
1107737645 13:43416219-43416241 GCTCCTCACTTCCCAGATGATGG + Intronic
1107737720 13:43416480-43416502 GCTCCTCACTTCCCAGATGATGG + Intronic
1107953434 13:45485848-45485870 GCTCCTCACATCCCAGATGATGG + Intronic
1108071108 13:46629550-46629572 CATCCTCAGGGCCCATGTGATGG + Intronic
1108608474 13:52063532-52063554 GCTCCTCACGTCCCAGACGATGG - Intronic
1108610443 13:52079759-52079781 GCTCCTCACGTCCCAGACGATGG - Intronic
1109400362 13:61819699-61819721 GATCCTCAGTACCTGGGTGATGG + Intergenic
1110626331 13:77660037-77660059 GCTCCTCACTTCCCAGGTGGTGG + Intergenic
1110666196 13:78119963-78119985 GCTACTCAGGAGCCTGATGAGGG + Intergenic
1111230681 13:85341043-85341065 GCTCCTCACAACCCAGACGATGG + Intergenic
1112070624 13:95845961-95845983 GCTCCTCACATCCCAGATGATGG + Intronic
1112661536 13:101514846-101514868 GCTCCTGAGGTCCCAGGCTAGGG + Intronic
1113329055 13:109311357-109311379 GCTCCTCACGTCCCAGACGATGG - Intergenic
1114174709 14:20309802-20309824 GCTCCTCACGTCCCAGACGATGG - Intergenic
1115504217 14:34078776-34078798 GCTCCTCACGTCCCAGACGATGG - Intronic
1115847753 14:37556087-37556109 GCTCCTCACGTCCCAGACGATGG + Intergenic
1116192125 14:41675139-41675161 GCTCCTCACGTCCCAGACGATGG + Intronic
1117276928 14:54203078-54203100 GCTCCTCACGTCCCAGACGATGG - Intergenic
1117411793 14:55456808-55456830 GCTCCTCACGTCCCAGACGATGG + Intergenic
1117763737 14:59059203-59059225 GCTCCTCACATCCCAGATGATGG + Intergenic
1118184084 14:63522403-63522425 GCTCCTCACGTCCCAGATGATGG - Intronic
1118323813 14:64768552-64768574 TCTCATCAGCACCCAGCTGAAGG + Intronic
1118517809 14:66546307-66546329 GCTCCTCACGTCCCAGATGATGG + Intronic
1118890279 14:69903077-69903099 GCTCCTCACATCCCAGATGATGG - Intronic
1118955522 14:70477425-70477447 GCTCCTCACATCCCAGATGATGG - Intergenic
1119254668 14:73185142-73185164 GCTCCTCACATCCCAGATGATGG + Intronic
1120170618 14:81244787-81244809 GCTCCTCACATCCCAGATGATGG + Intergenic
1120445150 14:84586041-84586063 ACTCCTCAGGCCCCAGATTATGG - Intergenic
1120547670 14:85830189-85830211 GCTCCTCACGTCCCAGACGATGG + Intergenic
1120778414 14:88463131-88463153 GGTCTTCAGCACCCAGCTGAAGG - Intronic
1121142979 14:91557883-91557905 GCTCCTCACGTCCCAGACGATGG + Intergenic
1121742607 14:96264633-96264655 GCTCTTCAGGACCAAGGTCTGGG + Exonic
1122356493 14:101125962-101125984 GCTCCTCAGCACCCGGGTCTGGG + Intergenic
1124067188 15:26355177-26355199 GCTGGGGAGGACCCAGGTGAGGG - Intergenic
1124111910 15:26798272-26798294 GCTTCTCAGGACCCTGGGCACGG - Intronic
1125032006 15:35082741-35082763 GCTCCTCAAATCCCAGATGATGG - Intergenic
1125459742 15:39894756-39894778 GCTCCTCACATCCCAGATGATGG + Intronic
1125770027 15:42159117-42159139 GCTCCTCCGAACTCTGGTGAAGG + Exonic
1126125795 15:45293487-45293509 GCTCCTCACGTCCCAGACGATGG + Intergenic
1126517275 15:49550818-49550840 GCTCCTCACGTCCCAGACGATGG + Intronic
1126713195 15:51483966-51483988 GCTCCTCAGGCCTGAGGTGTGGG - Intronic
1127088638 15:55446551-55446573 GCTCCTCACATCCCAGATGAAGG + Intronic
1127088741 15:55446932-55446954 GCTCCTCACATCCCAGATGATGG + Intronic
1127088799 15:55447159-55447181 GCTCCTCACATCCCAGATGATGG + Intronic
1127849714 15:62902040-62902062 GCTCCTCAGGGCCCTGAGGAGGG + Intergenic
1127857318 15:62963128-62963150 CATCCTCAGGCTCCAGGTGAGGG + Intergenic
1128490327 15:68136138-68136160 GCTCCTCACGTCCCAGACGATGG + Intronic
1129054227 15:72807607-72807629 GCTCCTCACGTCCCAGACGATGG + Intergenic
1129313701 15:74728731-74728753 GCTCCTCACGTCCCAGACGATGG - Intergenic
1129431143 15:75503095-75503117 GCTCCTCACGTCCCAGACGATGG - Intronic
1129735910 15:77963157-77963179 GCTACTCAGGAGGCAGATGAAGG - Intergenic
1130071072 15:80647413-80647435 GCTCCTCACATCCCAGATGATGG - Intergenic
1130428446 15:83822731-83822753 GCTCCTCACGTCCCAGACGATGG + Intronic
1131131617 15:89904042-89904064 GCCTCTCAGGAGCCAGGTGAGGG + Intronic
1131303517 15:91220973-91220995 GCTCCTCAGGAGGCAGAGGAAGG - Intronic
1132300843 15:100774532-100774554 GCTCCTCACGTCCCAGACGATGG + Intergenic
1132598391 16:763306-763328 GGTCTTCAGGTCCCAGGTGGGGG + Intronic
1132921894 16:2400299-2400321 GCTCCTCACATCCCAGATGATGG + Intergenic
1133746529 16:8691291-8691313 GGTCCTCAGAAACCAAGTGAGGG + Intronic
1133833860 16:9350256-9350278 GCTCCTCACCTCCCAGATGATGG + Intergenic
1134471896 16:14532942-14532964 GCTCCTCACGTCCCAGACGATGG + Intronic
1134630023 16:15749844-15749866 GCTCCCCAGCACCCAGGACAGGG + Intronic
1134854373 16:17506346-17506368 GCTCCTCACGTCCCAGACGATGG + Intergenic
1135639778 16:24109643-24109665 GCTCCTCACATCCCAGATGATGG + Intronic
1136165099 16:28448402-28448424 GCTCCTCACATCCCAGATGATGG - Intergenic
1136197866 16:28666578-28666600 GCTCCTCACATCCCAGATGATGG + Intergenic
1136214213 16:28780755-28780777 GCTCCTCACATCCCAGATGATGG + Intergenic
1136258930 16:29060600-29060622 GCTCCTCACATCCCAGATGATGG + Intergenic
1136656231 16:31710964-31710986 GGTCCTCAGTTCCCAGCTGAGGG + Intergenic
1137270263 16:46898333-46898355 CCTCCTCAGGCTCCAGGAGAAGG + Intronic
1137493409 16:48951555-48951577 GCTCCTCACATCCCAGATGATGG - Intergenic
1138028149 16:53539036-53539058 GCTCCTCACGTCCCAGACGATGG - Intergenic
1139790666 16:69431658-69431680 GCTCCTCAGGAGGCAGGGGTGGG + Intronic
1140063222 16:71589298-71589320 GCTCCTCACATCCCAGATGATGG - Intergenic
1140188674 16:72796315-72796337 GCTCCACAGGTCCCAGCTGCGGG + Exonic
1140994007 16:80242994-80243016 GCTCCTCACATCCCAGATGATGG - Intergenic
1141427509 16:83953503-83953525 GCTCCAGAGAACCCAGGCGAGGG - Intronic
1141999988 16:87658770-87658792 TCTCAGCAGGCCCCAGGTGAGGG - Intronic
1142034522 16:87855149-87855171 TCTCCTCAGGACCCTGGGGTGGG + Intronic
1142181910 16:88675335-88675357 CCTCCTCAAGACCCGGGTGCTGG + Intergenic
1142319196 16:89370205-89370227 TCTTCTCAGGACTCAGGCGAGGG + Intronic
1142332252 16:89462528-89462550 GCTCCTCACATCCCAGATGATGG - Intronic
1142456115 16:90224659-90224681 TCTCCTCAGGACCCACCCGAGGG + Intergenic
1142533535 17:598420-598442 GCTCCTCACATCCCAGATGATGG - Intronic
1142560752 17:807579-807601 GCTCCTCAGAAGCCAGGTGGGGG - Intronic
1142634329 17:1247431-1247453 GCTCCTCACATCCCAGATGATGG + Intergenic
1142705334 17:1690156-1690178 GCTCCTCACATCCCAGATGATGG + Intergenic
1142825259 17:2506745-2506767 GCTCCTCACATCCCAGATGATGG - Intronic
1142922988 17:3207463-3207485 TCCCCTCGGGACACAGGTGAAGG + Intergenic
1142939972 17:3372360-3372382 GCTCCTCACGTCCCAGACGATGG + Intergenic
1143026987 17:3946817-3946839 GCTCCTCCTGACCCAGCAGATGG - Intronic
1143277272 17:5721437-5721459 GCTCCTCACGTCCCAGACGATGG + Intergenic
1143689580 17:8550147-8550169 GCTCCTCACATCCCAGATGATGG - Intronic
1143884725 17:10057253-10057275 GCTCCTCACATCCCAGATGATGG - Intronic
1144773207 17:17770938-17770960 GCTCCTAAGGACCCAGGGCCTGG + Intronic
1145022196 17:19441279-19441301 GCTCCTCACGTCCCAGACGATGG - Intergenic
1145027014 17:19475818-19475840 GCTCCTCACATCCCAGATGATGG - Intergenic
1145053895 17:19685419-19685441 GCTCCTCACATCCCAGATGATGG - Intronic
1145684163 17:26638000-26638022 GCTCCTCACGTCCCAGACGATGG - Intergenic
1146520435 17:33521811-33521833 GCTCCTCAGAACCCTGATGTGGG + Intronic
1146790476 17:35747924-35747946 GATCCTCCGGAACCATGTGATGG - Exonic
1147213828 17:38887615-38887637 GGTGGCCAGGACCCAGGTGAGGG + Intronic
1147845809 17:43403197-43403219 GCTCCTCAGCACCCATGCCAGGG - Intergenic
1147981997 17:44280471-44280493 GGTCCTCAGGACCTAGCAGAAGG - Intergenic
1148016245 17:44524484-44524506 GCTCCTCACATCCCAGATGATGG - Intergenic
1148404188 17:47397471-47397493 GCTCCTCACGTCCCAGACGATGG - Intronic
1148406382 17:47420406-47420428 GCTCCTCACGTCCCAGATGATGG - Intronic
1148450463 17:47774459-47774481 GCTCCTCAGGACCATGTAGAGGG - Intergenic
1148759993 17:49994667-49994689 CCAGCCCAGGACCCAGGTGAGGG - Exonic
1149501983 17:57159852-57159874 GCTACTCAGGAGCCTGGGGAAGG + Intergenic
1150213833 17:63456272-63456294 GCTCCTCACGTCCCAGACGATGG - Intergenic
1150894664 17:69196394-69196416 GCTCCTCACATCCCAGATGATGG + Intronic
1151967188 17:77437551-77437573 GCCCCTCAGGGACCAGGTGAGGG + Intronic
1151977066 17:77489077-77489099 GCTCCCCAAGACGCAGCTGAAGG - Intronic
1152129066 17:78465389-78465411 GCTCCTCACATCCCAGATGATGG - Intronic
1152408080 17:80108655-80108677 TCTCCTCAGGCCCCAGCAGACGG + Intergenic
1152611451 17:81316739-81316761 GCTCCCCAGGGCCCGGCTGACGG + Intronic
1152639996 17:81445368-81445390 GCTCCTCCAGATCCAGGTGCTGG - Exonic
1152951115 17:83232445-83232467 TCTCCTCAGGACCCACCCGAGGG + Intergenic
1153929916 18:9869210-9869232 GGTCCTCAGGACACACCTGAGGG - Intergenic
1154003594 18:10506793-10506815 GCTCCTCACTTCCCAGATGATGG + Intergenic
1154116035 18:11613811-11613833 GCTCCTCACCTCCCAGATGATGG - Intergenic
1154438048 18:14361389-14361411 ACTCCTCAGGACACATGTGTGGG - Intergenic
1154483103 18:14855948-14855970 GCTCCTCACCTCCCAGATGATGG + Intergenic
1154483251 18:14856514-14856536 GCTCCTCACCTCCCAGATGATGG + Intergenic
1154483525 18:14857571-14857593 GCTCCTCACCTCCCAGATGATGG + Intergenic
1154483670 18:14858134-14858156 GCTCCTCACCTCCCAGATGATGG + Intergenic
1154483946 18:14859191-14859213 GCTCCTCACCTCCCAGATGATGG + Intergenic
1154484091 18:14859754-14859776 GCTCCTCACCTCCCAGATGATGG + Intergenic
1154484190 18:14860176-14860198 GCTCCTCACCTCCCAGATGATGG + Intergenic
1155042104 18:22073449-22073471 GTTTCTCAAGACCCAGGTCATGG + Intergenic
1156326423 18:36078187-36078209 GCTCCTCACGTCCCAGACGATGG + Intergenic
1156468330 18:37362019-37362041 GGACCCCAGGACCCAGGTGAAGG - Intronic
1157046536 18:44107097-44107119 TCTCCATGGGACCCAGGTGAAGG + Intergenic
1157629559 18:49081040-49081062 GCTCCTCACGTCCCAGACGATGG + Intronic
1157778580 18:50417851-50417873 GCTCCTCACTTCCCAGATGATGG + Intergenic
1158646833 18:59255438-59255460 GCTCCTCACATCCCAGATGATGG - Intergenic
1159169719 18:64750127-64750149 GCTGCTCAGGAGCCATGTCAAGG - Intergenic
1159340525 18:67127213-67127235 GCTCCTCACATCCCAGATGATGG + Intergenic
1160171885 18:76562229-76562251 GCTCCTCAGGAAGCAGCCGAGGG - Intergenic
1160345020 18:78125043-78125065 CCTCAGCAGGACCAAGGTGAAGG + Intergenic
1160500678 18:79400051-79400073 GCTCCTCCGGACCCGGGGGTAGG - Intronic
1160916659 19:1499785-1499807 GCTCCTCATGTCCCAGACGATGG + Intergenic
1161790142 19:6355282-6355304 GCTCCTCACGTCCCAGACGATGG - Intergenic
1162019966 19:7863873-7863895 GCTCCTCAGGGCCCCGGGGCAGG + Intronic
1162278895 19:9679800-9679822 GCTCCTCACATCCCAGATGATGG - Intergenic
1162683169 19:12362179-12362201 GCTCCTCACATCCCAGATGATGG - Intronic
1163446171 19:17347691-17347713 ACTCCTCAGGAACCGGGTGGGGG - Intergenic
1163913047 19:20214356-20214378 GCTCCTCACATCCCAGATGATGG - Intergenic
1163921702 19:20296222-20296244 GCTCCTCACATCCCAGATGATGG - Intergenic
1163945580 19:20530764-20530786 GCTCCTCACATCCCAGATGATGG + Intergenic
1164016596 19:21260283-21260305 GCTCCTCACTTCCCAGATGATGG + Intronic
1164016613 19:21260359-21260381 GCTCCTCACCTCCCAGATGAAGG + Intronic
1164016794 19:21261044-21261066 GCTCCTCACTTCCCAGATGATGG + Intronic
1164034853 19:21443976-21443998 GCTCCTCACATCCCAGATGATGG + Intronic
1164043267 19:21511613-21511635 GCTCCTCACATCCCAGATGATGG + Intronic
1164054961 19:21614750-21614772 GCTCCTCACATCCCAGATGATGG - Intergenic
1164256712 19:23533868-23533890 GCTCCTCACATCCCAGATGATGG + Intronic
1164301078 19:23963863-23963885 GCTCCTCACATCCCAGATGATGG - Intergenic
1165295489 19:34922509-34922531 GCTCCTCACATCCCAGATGATGG + Intergenic
1165727792 19:38124538-38124560 GCTCCTCACGTCCCAGACGATGG + Intronic
1165768374 19:38364458-38364480 GCTCCTCACGTCCCAGACGATGG + Intronic
1165842728 19:38798352-38798374 ACTCCTCACGTCCCAGATGATGG + Intergenic
1165898962 19:39159749-39159771 GCTCTTCAGGACCCAGGCTAAGG + Intronic
1166191529 19:41179971-41179993 GCTCCTCACGTCCCAGACGATGG - Intergenic
1166418107 19:42610807-42610829 GCTCCTCACGTCCCAGACGATGG + Intronic
1166843720 19:45713531-45713553 GCATCTCAGGACCTAGGTGGTGG + Exonic
1167540813 19:50086214-50086236 GCTCCTCACGTCCCAGACGATGG - Intergenic
1168058143 19:53875024-53875046 GCTCCCAAGGACACAGGAGAAGG - Exonic
1168572544 19:57483038-57483060 GCTCCTCACGTCCCAGACGATGG - Intergenic
1168658223 19:58147010-58147032 GCTCCTCACGTCCCAGATGATGG - Intronic
1168696313 19:58405882-58405904 GCTCCTCACATCCCAGATGATGG + Intronic
924970884 2:126664-126686 GCTCCTCACGTCCCAGACGATGG - Intergenic
924971183 2:128293-128315 GCTCCTCAGGAGCAAGGAGGAGG + Intergenic
925384629 2:3453513-3453535 GCTGCTGAGGGCCCAGGCGAGGG - Intronic
925640482 2:5981842-5981864 GCTCCTCCTGACTCAGCTGAAGG + Intergenic
926215618 2:10903404-10903426 GCTCCTCACAACCCAGACGATGG + Intergenic
926675132 2:15612543-15612565 GCTCCTCACGTCCCAGATGATGG + Intronic
928888742 2:36179776-36179798 GCTCCTCACGTCCCAGACGATGG - Intergenic
929110587 2:38403155-38403177 GCTCCTCACGTCCCAGACGATGG - Intergenic
929690386 2:44067872-44067894 GCTCCTCACGTCCCAGACGATGG + Intergenic
929789790 2:45014061-45014083 GCCCCTCCGCACCCAGGCGAAGG - Intergenic
930665656 2:54096369-54096391 GCTCCTCACGTCCCAGACGATGG + Intronic
931576329 2:63722188-63722210 GCTCCTCACATCCCAGATGATGG - Intronic
931584173 2:63808801-63808823 GCTCCTCATGTCCCAGACGATGG - Intronic
931604820 2:64041998-64042020 GCTCCTCACGTCCCAGATGATGG + Intergenic
931633682 2:64323298-64323320 GCCACTCAGGACCCAGGGGAAGG - Intergenic
931706137 2:64947926-64947948 CCTCCTCAGGCCCCAGTAGAGGG + Intergenic
932758690 2:74425859-74425881 TGTCCTCAGGAGCCAGGTGAAGG + Exonic
932807616 2:74796566-74796588 GCTCCTCACGTCCCAGACGACGG + Intergenic
934128293 2:88920377-88920399 GCTCCTCACATCCCAGATGATGG - Intergenic
934502295 2:94870567-94870589 GCTCCCCTGGCCCCAGGTTAGGG + Intergenic
934607306 2:95706389-95706411 GTTTCTCAGGACACAGGAGAAGG + Intergenic
936186421 2:110307263-110307285 GCTCCTCACATCCCAGATGATGG - Intergenic
936345583 2:111672649-111672671 GCTCCTCACATCCCAGATGATGG - Intergenic
937239732 2:120452307-120452329 GCTCCACAGGTGCCAGGTCAGGG + Intergenic
938829194 2:135034344-135034366 GCTCCTCACGTCCCAGACGATGG + Intronic
940299069 2:152160188-152160210 GCTCCTCACATCCCAGATGATGG - Intronic
940635513 2:156293321-156293343 GCTCCTCACATCCCAGATGATGG - Intergenic
940652487 2:156452090-156452112 GCTCCTCACGTCCCAGACGATGG + Intronic
941768650 2:169326675-169326697 GCTCCTCACGTCCCAGACGATGG - Intronic
941847688 2:170149497-170149519 GCTCCTCACATCCCAGATGATGG - Intergenic
942021100 2:171867169-171867191 GCTCCTCACGTCCCAGACGATGG + Intronic
943125906 2:183792888-183792910 GCTCCTCACTTCCCAGATGATGG + Intergenic
943418551 2:187637524-187637546 GCTCCTCACATCCCAGATGATGG + Intergenic
944138473 2:196428249-196428271 GCTTCTCAGGACACAACTGAAGG + Intronic
944263224 2:197696947-197696969 GCTCCTCACGTCCCAGACGATGG + Intronic
944722742 2:202440503-202440525 GCTCCTCACATCCCAGATGATGG + Intronic
944733141 2:202535621-202535643 GCTCCTCACATCCCAGATGATGG + Intronic
944751656 2:202715618-202715640 GCTCCTCACATCCCAGATGATGG + Intronic
944785607 2:203066836-203066858 GCTCCTCACATCCCAGATGATGG + Intronic
944815659 2:203372999-203373021 GCTCCTCACGTCCCAGACGATGG + Intronic
946304112 2:218846359-218846381 GCTCCTCACATCCCAGATGATGG - Intergenic
946318060 2:218931258-218931280 GCTCCTCACATCCCAGATGATGG - Intergenic
946447426 2:219751536-219751558 GCTCCTCACATCCCAGATGATGG + Intergenic
947402267 2:229742638-229742660 GCTCCTCACGTCCCAGACGATGG - Intergenic
947586668 2:231360849-231360871 GCGCCCCAGGACCCAGGCAATGG + Intronic
947734285 2:232446709-232446731 GCACCGCAGGAGGCAGGTGAGGG - Intergenic
947797727 2:232905561-232905583 GCTCCTCACGTCCCAGACGATGG - Intronic
947938107 2:234024846-234024868 TCTCCCCAGGACCCAGCTAAGGG + Intergenic
948251922 2:236536235-236536257 GCTCCTCAGTGCCCAGTGGATGG - Intergenic
948375915 2:237520082-237520104 GGTGCTCAGGCCCCAGGTGAGGG + Intronic
949087611 2:242169460-242169482 TCTCCTCAGGACCCACCCGAGGG + Intergenic
1169125682 20:3125303-3125325 GCTCCTCACTTCCCAGATGATGG - Intronic
1169125713 20:3125416-3125438 GCTCCTCACTTCCCAGATGATGG - Intronic
1169125793 20:3125725-3125747 GCTCCTCACCTCCCAGATGATGG - Intronic
1169273526 20:4218132-4218154 GCACCTGAGGACCCAGGAAATGG + Intergenic
1169449810 20:5701811-5701833 GCTCCTCACATCCCAGATGATGG - Intergenic
1169718206 20:8644254-8644276 GCTCCTCATGTCCCAGACGATGG - Intronic
1169788410 20:9385371-9385393 GCTCCTCACCTCCCAGATGATGG + Intronic
1169908791 20:10630272-10630294 GCTCCAGAGGAGGCAGGTGATGG + Intronic
1170474432 20:16700949-16700971 GGTCACCAGGAGCCAGGTGAGGG - Intergenic
1171291833 20:23986746-23986768 GCTCCCCAGGACCCAAGGGCAGG + Intronic
1171861165 20:30404677-30404699 ACTCCTCACGTCCCAGGCGATGG - Intergenic
1171951553 20:31426759-31426781 GCTCCTCACGTCCCAGACGATGG - Intergenic
1171957575 20:31471939-31471961 GCTCCTCACGTCCCAGACGATGG + Intronic
1172106614 20:32520866-32520888 GCTCATCAGGAACCGGGTCACGG + Intronic
1172199540 20:33115422-33115444 GCTCCTCACGTCCCAGACGATGG - Intergenic
1172258191 20:33537024-33537046 GCTCCTCACGTCCCAGACGATGG + Intronic
1172348471 20:34223087-34223109 GCTCCTCACATCCCAGATGATGG - Intronic
1172401876 20:34658452-34658474 GCTCCTCACATCCCAGATGATGG - Intronic
1172575122 20:36001933-36001955 GCTCCTCACGTCCCAGACGATGG + Intronic
1173273245 20:41555788-41555810 GCTCCTCACGTCCCAGACGATGG + Intronic
1173508516 20:43607683-43607705 GCTCCTCACATCCCAGATGATGG + Intronic
1174488029 20:50873378-50873400 GGTCCTGAGGACCCAGGCAAGGG - Intronic
1175545246 20:59773710-59773732 GCCCCTCAGGACCCAGGGTGGGG + Intronic
1175918736 20:62440027-62440049 GCTGCTCAGGGCACAGGTGTGGG - Intergenic
1175918741 20:62440049-62440071 GCTGCTCAGGGCACAGGTGTGGG - Intergenic
1176215070 20:63944141-63944163 GGTGCTCAGGACCCAGCCGAGGG - Intronic
1176656760 21:9594063-9594085 GCTCCTCACATCCCAGATGATGG + Intergenic
1176797335 21:13379940-13379962 GCTCCTCACCTCCCAGATGATGG - Intergenic
1176852941 21:13935995-13936017 GCTCCTCACTTCCCAGATGATGG + Intergenic
1176853160 21:13936832-13936854 GCTCCTCACATCCCAGATGATGG + Intergenic
1178034313 21:28563669-28563691 GCTCCTCACGTCCCAGACGATGG - Intergenic
1178436652 21:32565829-32565851 GATCCTCAGGTCCCCGGTGAGGG - Intergenic
1180765568 22:18344360-18344382 GCTCCCCAGGACCCAAGGGCAGG - Intergenic
1180780748 22:18518032-18518054 GCTCCCCAGGACCCAAGGGCAGG + Intronic
1180813461 22:18775339-18775361 GCTCCCCAGGACCCAAGGGCAGG + Intergenic
1180861211 22:19084179-19084201 GCTCCTCACATCCCAGATGACGG - Intronic
1180879389 22:19193089-19193111 GCTCCTCAGGCCTCCCGTGAAGG + Intronic
1180963428 22:19773298-19773320 GCTGCTCAGGCCCCAGAGGAAGG + Intronic
1181199643 22:21209669-21209691 GCTCCCCAGGACCCAAGGGCAGG + Intronic
1181400116 22:22646189-22646211 GCTCCCCAGGACCCAAGGGCAGG - Intronic
1181649248 22:24249601-24249623 GCTCCCCAGGACCCAAGGGCAGG + Intergenic
1181702089 22:24627287-24627309 GCTCCCCAGGACCCAAGGGCAGG - Intronic
1182331059 22:29552244-29552266 GCTCCTCACATCCCAGATGATGG - Intronic
1182355987 22:29722415-29722437 GCTCCCCAGGGCCCAGGAGAAGG - Intronic
1182484628 22:30632027-30632049 GCTCCTCACGTCCCAGACGATGG + Intergenic
1182780678 22:32864959-32864981 ACTTCTCAGGACCCAGGGAATGG + Exonic
1183167515 22:36159087-36159109 GCTCCTCAGAGCTCAGATGACGG - Intronic
1183272613 22:36871574-36871596 GCTCCTCTGGACACAGGAGCAGG + Intronic
1183434668 22:37786646-37786668 GCTCCTCACGTCCCAGACGATGG - Intergenic
1183524468 22:38315353-38315375 GCTCCTTGGGAGCCAGGTGCCGG - Intronic
1184415104 22:44347658-44347680 GCTCCTCAGGGCCCAGGCTCCGG - Intergenic
1184842252 22:47058863-47058885 GGCCCGCTGGACCCAGGTGAAGG + Intronic
1184900004 22:47440134-47440156 GCTCCTCACATCCCAGATGATGG + Intergenic
1185166389 22:49265080-49265102 GCCCCTGAGGACCCAGGAGGAGG + Intergenic
1185326437 22:50228005-50228027 CCTCCTCAGGCCACTGGTGAAGG + Exonic
1185360704 22:50405071-50405093 GCCGCTCAGGAACCATGTGAGGG - Intronic
1203227190 22_KI270731v1_random:85250-85272 GCTCCCCAGGACCCAAGGGCAGG - Intergenic
1203263562 22_KI270734v1_random:1021-1043 GCTCCCCAGGACCCAAGGGCAGG + Intergenic
949484431 3:4524147-4524169 GGTCCCCTGCACCCAGGTGAGGG + Intronic
949853255 3:8439511-8439533 GCTCCTCACGTCCCAGATGATGG - Intergenic
949988742 3:9560088-9560110 GCTCCTCACGTCCCAGAGGATGG - Intergenic
950187233 3:10952632-10952654 GCTCTTCAGGGCCCATGTGTGGG + Intergenic
950412794 3:12850058-12850080 GCTCCTCACGTCCCAGACGATGG + Intronic
950413791 3:12856592-12856614 GCTCCAAAGGACCCATGGGAAGG + Intronic
950417306 3:12875978-12876000 GCTCCAAAGGACCCATGGGAAGG + Intergenic
950498222 3:13347117-13347139 GCCTCACAGGACCCAGGAGATGG + Intronic
950590779 3:13934676-13934698 ACTCCTGAGGACCAAGGAGAGGG + Intergenic
950742321 3:15061675-15061697 GCTCCTCACATCCCAGATGATGG - Intronic
950754987 3:15163677-15163699 GCTCCTCACGTCCCAGACGATGG + Intergenic
950819442 3:15742196-15742218 GCTCCTCACGTCCCAGACGATGG - Intronic
950869036 3:16213023-16213045 CCTCCCCTGGCCCCAGGTGAGGG - Intronic
951550604 3:23871909-23871931 GCTCCTCACGTCCCAGACGATGG + Intronic
951642755 3:24854512-24854534 ACTACTAAGTACCCAGGTGAAGG - Intergenic
952308803 3:32169550-32169572 GCTCCTCACGTCCCAGACGATGG - Intergenic
952497784 3:33931165-33931187 GCACCTGGGGGCCCAGGTGAGGG + Intergenic
953652838 3:44821660-44821682 GCTCCTCACGTCCCAGATGATGG + Intronic
953905359 3:46865861-46865883 CCTCATCAGGACCCAGATGAAGG + Intronic
953966264 3:47309536-47309558 GCTCCTCACGTCCCAGATGATGG + Intronic
954396285 3:50295110-50295132 GCTCCTGAGGGTCCAGGTCAGGG + Exonic
954841510 3:53515695-53515717 GCTCCTCAGGACCCAGGTGATGG + Intronic
954993543 3:54861494-54861516 GCTCCTCATGTCCTAGGTGATGG - Intronic
955674636 3:61435265-61435287 GCTCCTCACATCCCAGATGATGG + Intergenic
957951613 3:87134897-87134919 GACTGTCAGGACCCAGGTGAGGG - Intergenic
958406131 3:93760864-93760886 GCTCCTCACCTCCCAGATGATGG + Intergenic
958406142 3:93760903-93760925 GCTCCTCACCTCCCAGATGATGG + Intergenic
958406433 3:93761884-93761906 GCTCCTCACCTCCCAGATGATGG + Intergenic
958406539 3:93762259-93762281 GCTCCTCACTTCCCAGATGATGG + Intergenic
958431338 3:94044231-94044253 GCTCCTCACATCCCAGATGATGG - Intronic
958692027 3:97481012-97481034 GCTCCTCACATCCCAGATGATGG + Intronic
960535325 3:118809043-118809065 GCTCCAGAGGATGCAGGTGAGGG + Intergenic
960817481 3:121688645-121688667 GCTCCTCACGTCCCAGACGATGG - Intronic
960866147 3:122201955-122201977 GCTCCTCACATCCCAGATGATGG + Intronic
961784787 3:129341285-129341307 GCTCCAAAGGACCCATGAGAAGG + Intergenic
962572096 3:136723151-136723173 GCTCCTCACGTCCCAGACGATGG - Intronic
962623136 3:137198816-137198838 GCTCCTCATATCCCAGATGATGG + Intergenic
962688762 3:137872610-137872632 GCTCCTCACAACCCAGACGATGG - Intergenic
962761780 3:138521383-138521405 GCTCCTCACATCCCAGATGATGG - Intronic
963249166 3:143087124-143087146 GCTCCTCACGTCCCAGACGATGG + Intergenic
963776425 3:149445164-149445186 GCTCCTCACATCCCAGATGATGG + Intergenic
964485078 3:157178649-157178671 GCTCCTCACTTCCCAGATGATGG + Intergenic
964485125 3:157178835-157178857 GCTCCTCACATCCCAGATGATGG + Intergenic
964485155 3:157178950-157178972 GCTCCTCACTTCCCAGATGATGG + Intergenic
964485174 3:157179028-157179050 GCTCCTCACTTCCCAGATGATGG + Intergenic
964485239 3:157179289-157179311 GCTCCTCACTTCCCAGATGATGG + Intergenic
964485305 3:157179546-157179568 GCTCCTCACATCCCAGATGATGG + Intergenic
965649991 3:170923459-170923481 GCTCCTCACATCCCAGATGATGG - Intergenic
965690540 3:171351964-171351986 AGTCCTCAGGACCAAGGAGATGG + Intronic
966206753 3:177413192-177413214 GCTCCTCACATCCCAGATGATGG + Intergenic
967524194 3:190473161-190473183 GCTCCTCACATCCCAGATGATGG - Intergenic
967578582 3:191125320-191125342 GCTCCTCACGTCCCAGACGATGG + Intergenic
967981442 3:195068138-195068160 GATCCTAAGGACCAAGGAGAGGG - Intergenic
968374053 4:23098-23120 TCTCCTCAGGACCCACCCGAGGG - Intergenic
969458056 4:7312317-7312339 GCTTCTCAGGGTCCAGCTGAGGG - Intronic
972270789 4:37509499-37509521 GCTCCTCACTTCCCAGATGATGG + Intronic
972412341 4:38807299-38807321 GCTCCTCACGTCCCAGACGATGG - Intronic
972551852 4:40141623-40141645 GCTCCTCACGTCCCAGATGATGG + Intronic
973021251 4:45207785-45207807 GCTCCTCACCTCCCAGATGAAGG - Intergenic
973021398 4:45208322-45208344 GCTCCTCACCTCCCAGATGAAGG - Intergenic
973673252 4:53238897-53238919 GCTCCTCACATCCCAGATGATGG + Intronic
974848606 4:67380750-67380772 GCTCCTCACATCCCAGATGATGG - Intergenic
974848742 4:67381284-67381306 GCTCCTCACCTCCCAGATGAAGG - Intergenic
976207211 4:82634690-82634712 GCTCCTTAGGGCCCATGTCATGG + Intronic
976265001 4:83181936-83181958 GCTCCTCACGTCCCAGACGATGG - Intergenic
976781129 4:88760273-88760295 GCTCATCAGGACCCGATTGATGG - Intronic
976976162 4:91168254-91168276 GCTCCTCACTTCCCAGATGATGG - Intronic
976976248 4:91168555-91168577 GCTCCTCAATTCCCAGATGATGG - Intronic
978527108 4:109678417-109678439 GCTCCTCACTTCCCAGATGATGG + Intronic
978820334 4:112958131-112958153 GCTCCTCACGTCCCAGACGATGG + Intronic
978888661 4:113796370-113796392 GCTCCTCACATCCCAGATGATGG - Intergenic
979641707 4:123016658-123016680 GCTCCTCACGTCCCAGACGATGG + Intronic
981993619 4:150953821-150953843 GCTCCTCACATCCCAGATGATGG - Intronic
983218222 4:165020484-165020506 GCTCCTCACGTCCCAGACGATGG + Intergenic
983604481 4:169569951-169569973 GCTCCTCACGTCCCAGACGATGG - Intronic
984005026 4:174295524-174295546 GCTCCTCACGTCCCAGACGATGG + Intronic
984853316 4:184172354-184172376 GCTCTTCAGGAGGCAGGTGTTGG - Intronic
985460677 4:190103165-190103187 TCTCCTCAGGACCCACCCGAGGG + Intergenic
985529168 5:423863-423885 GCTGCTCAGGGCCCAGGAGTGGG + Exonic
985988402 5:3536132-3536154 GCTACGCTGGACCCAGGTGCGGG + Intergenic
987268079 5:16277396-16277418 GCTCCTCACATCCCAGATGATGG + Intergenic
987469221 5:18309443-18309465 GCTCCTCATGTCCCAGACGATGG - Intergenic
989574965 5:42980292-42980314 GCTCCTCACGTCCCAGACGATGG - Intergenic
989633411 5:43510900-43510922 GCTCCTCACATCCCAGATGATGG - Intronic
989634780 5:43521960-43521982 GCTCCTCACGTCCCAGACGATGG - Intergenic
989640534 5:43578685-43578707 GCTCCTCACGTCCCAGGCGATGG + Intergenic
989655977 5:43746510-43746532 GCTCCTCACATCCCAGATGATGG + Intergenic
989828804 5:45890435-45890457 GCTCCTCATATCCCAGATGATGG - Intergenic
989977980 5:50608256-50608278 GCTCCTCACCTCCCAGATGATGG - Intergenic
989991687 5:50774540-50774562 GCTCCTCATTTCCCAGATGATGG + Intronic
990459175 5:56015509-56015531 GCTCCTCACGTCCCAGACGATGG + Intergenic
990462093 5:56039132-56039154 GCTCCTCACGTCCCAGACGATGG + Intergenic
990485807 5:56258389-56258411 GCTCCTCACATCCCAGATGATGG + Intergenic
990709492 5:58564695-58564717 GCTCCTCACATCCCAGATGATGG + Intergenic
990819843 5:59825810-59825832 GATTCTCAGGACCAAGATGAGGG - Intronic
990871102 5:60431609-60431631 GCTCCTCACGTCCCAGACGATGG + Intronic
991373166 5:65940006-65940028 GCTCCTCACGTCCCAGACGATGG - Intronic
991723741 5:69516033-69516055 GCTCCTCACGTCCCAGACGATGG + Intronic
991935279 5:71794302-71794324 GCTCCTCACATCCCAGATGATGG + Intergenic
991935380 5:71794686-71794708 GCTCCTCACTTCCCAGATGATGG + Intergenic
992415885 5:76551391-76551413 GCTCCTCACATCCCAGATGATGG + Intronic
993934617 5:93985882-93985904 GCTCCTCATATCCCAGATGATGG - Intronic
995895045 5:117002430-117002452 GCTCCTCACGTCCCAGATGATGG + Intergenic
995942433 5:117600320-117600342 GCTCCTCACGTCCCAGACGATGG + Intergenic
996243476 5:121230222-121230244 GACCCTCAGGACCCAGGCAAAGG + Intergenic
996738544 5:126778204-126778226 GCCCCTCAGGCCCCAGGTGCGGG + Intronic
998021943 5:138777394-138777416 GCTCCTCACGTCCCAGACGATGG + Intronic
998025375 5:138811453-138811475 GCTCCTCACGTCCCAGACGATGG + Intronic
998041026 5:138951236-138951258 GGTCCTGAGGACCCTGGTGCAGG - Exonic
998060001 5:139112304-139112326 GCTCCTCACATCCCAGATGATGG - Intronic
998074380 5:139224336-139224358 GCTCCTCACGTCCCAGACGATGG - Intronic
998432280 5:142076879-142076901 GCTCCTCACATCCCAGATGATGG + Intergenic
999198128 5:149796749-149796771 GCTCCTCAGCAGCTGGGTGAAGG + Intronic
999374179 5:151075438-151075460 TATGCTCAGTACCCAGGTGATGG - Intronic
999455724 5:151714382-151714404 GCTCCTCACATCCCAGATGATGG + Intergenic
999532727 5:152480346-152480368 GCTCCTCACATCCCAGATGATGG + Intergenic
1000159077 5:158582257-158582279 GCTCCTCACGTCCCAGAAGATGG - Intergenic
1000630323 5:163584122-163584144 GCTCCTCACATCCCAGATGATGG + Intergenic
1001561950 5:172675515-172675537 GCTCCTCAGGGCCAAAGAGAAGG + Intronic
1001799690 5:174532229-174532251 GCTCCTCCAGACCCAGGAGATGG + Intergenic
1002031475 5:176433581-176433603 GCTCCTCACGTCCCAGACGATGG - Intergenic
1002222741 5:177696048-177696070 GCTCCTCACTTCCCAGATGATGG + Intergenic
1002222783 5:177696204-177696226 GCTCCTCACTTCCCAGATGATGG + Intergenic
1003259387 6:4503015-4503037 TCCCCTGAGGACCAAGGTGATGG - Intergenic
1004415068 6:15416224-15416246 GCTCCTCATGTCCCAGACGATGG + Intronic
1004664332 6:17736014-17736036 GCTCCTCACGTCCCAGACGATGG + Intergenic
1006065171 6:31456039-31456061 GCTCCTCACGTCCCAGACGATGG + Intergenic
1006432680 6:34007606-34007628 GCCCCTCAGAACCCAGGCTAAGG + Intergenic
1006460851 6:34156982-34157004 TGTCATCAGCACCCAGGTGAAGG - Intergenic
1006631348 6:35432344-35432366 ACCCCTCAGGACCCAGCTGCTGG + Intergenic
1006798898 6:36747059-36747081 CCACCTCAGGACCTTGGTGATGG + Intronic
1007965475 6:46000435-46000457 GTTCATCTGAACCCAGGTGATGG + Intronic
1008571975 6:52825293-52825315 GCTCCTCACTTCCCAGATGATGG - Intergenic
1008841682 6:55910522-55910544 GCTCCTCACGTCCCAGACGATGG + Intergenic
1009217821 6:60944759-60944781 GCTCCTCACATCCCAGATGATGG - Intergenic
1009392939 6:63164597-63164619 GCTCCTCACATCCCAGATGATGG - Intergenic
1009869208 6:69433482-69433504 GCTCCTCACTTCCCAGATGATGG + Intergenic
1010264501 6:73851499-73851521 GCTCCTCACATCCCAGATGATGG + Intergenic
1010400678 6:75442290-75442312 GCTCCTCACGTCCCAGACGATGG + Intronic
1010559736 6:77334143-77334165 GCTTCTCAGGCACCAGGGGAGGG - Intergenic
1012983773 6:105854433-105854455 GCTCCTCACGTCCCAGACGATGG + Intergenic
1013204487 6:107934180-107934202 GCTCCTCACGTCCCAGACGATGG - Intronic
1013243825 6:108269674-108269696 GCTCCTCACATCCCAGATGATGG - Intergenic
1013304036 6:108831736-108831758 GCTGCTCAGGTCCAAGGAGATGG + Intergenic
1013681388 6:112528703-112528725 GCTCCTCACGTCCCAGATGATGG + Intergenic
1016047649 6:139497045-139497067 GCTCTTCAGAACCCATTTGATGG + Intergenic
1017170315 6:151450068-151450090 GCTCCTCACGTCCCAGACGATGG - Intronic
1017352349 6:153457571-153457593 GGTCCTCAGGTCCCTGGTGAGGG - Intergenic
1017660585 6:156670095-156670117 GCTCCTCACGTCCCAGACGATGG - Intergenic
1017844121 6:158241283-158241305 GCTCCTCACATCCCAGATGATGG + Intronic
1017851603 6:158309427-158309449 GCTCCTCACGTCCCAGACGATGG + Intronic
1018887163 6:167949462-167949484 GCTCCTCAGGCCACAGATGTTGG + Intronic
1018977412 6:168575905-168575927 CCTCCCAAGCACCCAGGTGAAGG + Intronic
1019128326 6:169856613-169856635 GCTCCTCACCTCCCAGATGATGG + Intergenic
1019250263 6:170739805-170739827 TCTCCTCAGGACCCACCCGAGGG + Intergenic
1019551269 7:1603789-1603811 GGTCCTCAGGACACAGGCAAGGG + Intergenic
1019911955 7:4106159-4106181 GCTGCTCAGAAGGCAGGTGAGGG + Intronic
1019927793 7:4204773-4204795 GCTCCCCAGGGCCCAGCTCATGG + Intronic
1020284987 7:6671965-6671987 GCTCCTCACGTCCCAGACGATGG + Intergenic
1020498816 7:8890418-8890440 GCTCCTCACATCCCAGATGATGG - Intergenic
1021991798 7:26147955-26147977 GCTCCTCACATCCCAGATGATGG - Intergenic
1022083207 7:27044540-27044562 GCTCCTCACGTCCCAGGTGATGG - Intergenic
1022274031 7:28838651-28838673 GCTCCTCACGTCCCAGGCGATGG - Intergenic
1022757074 7:33304198-33304220 GCTCCTCACATCCCAGATGATGG - Intronic
1024062404 7:45708890-45708912 CCTCCTCACGACACAGGTGAGGG - Intronic
1024538621 7:50459416-50459438 GCTCCTCACGTCCCAGACGATGG - Intronic
1024772748 7:52743718-52743740 GCTCCTGCTGACCCATGTGAGGG - Intergenic
1024910670 7:54444058-54444080 GCTCCTCACAACCCAGACGATGG - Intergenic
1024910791 7:54444516-54444538 GCTCCTCACATCCCAGATGATGG - Intergenic
1024931360 7:54668273-54668295 GCTCCTCACGTCCCAGACGATGG + Intergenic
1025000509 7:55311675-55311697 GCTCCTCACGTCCCAGACGACGG - Intergenic
1025573075 7:62600185-62600207 GCTCCTCACATCCCAGATGATGG + Intergenic
1025793597 7:64717783-64717805 GCTCCTCACATCCCAGATGATGG - Intergenic
1025803746 7:64809994-64810016 GCTCCTCACATCCCAGATGATGG + Intronic
1026185838 7:68082150-68082172 GCTCCTCACCTCCCAGATGAAGG - Intergenic
1026185888 7:68082334-68082356 GCTCCTCACCTCCCAGATGAAGG - Intergenic
1026185909 7:68082410-68082432 GCTCCTCACCTCCCAGATGAAGG - Intergenic
1026185960 7:68082594-68082616 GCTCCTCACTTCCCAGATGAAGG - Intergenic
1026186070 7:68083046-68083068 GCTCCTCACATCCCAGATGATGG - Intergenic
1026868135 7:73835672-73835694 GCTCCTCACATCCCAGATGATGG - Intronic
1028361465 7:89972021-89972043 GCTCCTGAGGAGGCAGGTGTGGG - Intergenic
1028501139 7:91520248-91520270 GTTCCTCACAACCCAAGTGAAGG + Intergenic
1028535587 7:91887459-91887481 GCTCCTCACATCCCAGATGATGG - Intergenic
1028535794 7:91888179-91888201 GCTCCTCACTTCCCAGATGATGG - Intergenic
1028535862 7:91888446-91888468 GCTCCTCACTTCCCAGATGATGG - Intergenic
1028536016 7:91889015-91889037 GCTCCTCACTTCCCAGATGATGG - Intergenic
1028548083 7:92026791-92026813 GCTCCTCACATCCCAGATGATGG - Intronic
1028685700 7:93586622-93586644 GCTCCTCACGTCCCAGACGATGG + Intergenic
1029105756 7:98174385-98174407 GCTCCTCAGACTCCAGGTTAAGG - Intronic
1029569395 7:101359832-101359854 GCTCCTCACGTCCCAGACGATGG + Intergenic
1029702311 7:102255121-102255143 GCTCCTCACCACCCTGGTCAGGG + Exonic
1029813125 7:103069077-103069099 GCTCCTCACTTCCCAGGTGGTGG - Intronic
1030036396 7:105411281-105411303 GCTCCTCACGTCCCAGACGATGG + Intergenic
1032129500 7:129216538-129216560 GCTCCTCACATCCCAGATGATGG - Intergenic
1032541376 7:132705808-132705830 ACTCCTCAGCACCCAGGTTTGGG + Intronic
1033219821 7:139520584-139520606 GCTCCTCACATCCCAGATGATGG + Intergenic
1033293990 7:140114627-140114649 GCTCCTCACATCCCAGATGATGG - Intronic
1034233904 7:149554003-149554025 GCTCCTCACGTCCCAGACGATGG - Intergenic
1034942222 7:155237884-155237906 GTGCCTCAGGCCCCAGGTGCTGG - Intergenic
1035365083 7:158344123-158344145 GCTTCTAAGGGCCCAGGTGCTGG - Intronic
1035497116 8:61880-61902 TCTCCTCAGGACCCACCCGAGGG - Intergenic
1035534462 8:380399-380421 GTCCCCCAGGACCCAGGTGGGGG - Intergenic
1036821452 8:11943045-11943067 GCTCCCCAGCACACAGGGGAGGG + Intergenic
1037638345 8:20720428-20720450 GGGCCTCAGGAGCCAGGAGAGGG - Intergenic
1037841483 8:22248330-22248352 GCTTCTGGGGAGCCAGGTGAGGG + Intronic
1038291085 8:26250512-26250534 GCTGCTCATGACCCAGGGCAAGG + Intergenic
1039072348 8:33658759-33658781 GCTCCTCACGTCCCAGACGATGG + Intergenic
1039153470 8:34529732-34529754 GCTCCTCACGTCCCAGACGATGG + Intergenic
1039785232 8:40828988-40829010 GCTCCTCAGGACCATGGACAAGG - Intronic
1040296431 8:46151442-46151464 TCTTCCCAGTACCCAGGTGAAGG - Intergenic
1040296447 8:46151500-46151522 TCTTCCCAGAACCCAGGTGACGG - Intergenic
1040916853 8:52573145-52573167 GCTCCTCACCTCCCAGATGAAGG + Intergenic
1041378623 8:57227906-57227928 GCTCCGCAGGACCTGGATGAGGG + Intergenic
1042195991 8:66232122-66232144 GCTCCTCACGTCCCAGACGATGG - Intergenic
1042535606 8:69855643-69855665 GCTCCTCACCTCCCAGATGATGG - Intergenic
1043986095 8:86694836-86694858 GCTCCTCACGTCCCAGACGATGG + Intronic
1046703522 8:117426625-117426647 GCTCCTCACATCCCAGATGATGG - Intergenic
1046703552 8:117426741-117426763 GCTCCTCACATCCCAGATGATGG - Intergenic
1046984392 8:120371068-120371090 GTCTCTAAGGACCCAGGTGAGGG + Intronic
1047266513 8:123314508-123314530 GCTCCTCACATCCCAGATGATGG - Intergenic
1047782211 8:128119274-128119296 GCTCCTCACATCCCAGATGATGG + Intergenic
1049731516 8:144180866-144180888 GCATCCCAGGACCCAGGGGATGG + Intronic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1050417746 9:5433837-5433859 GCTCCTCACATCCCAGATGATGG - Intronic
1050417992 9:5434635-5434657 GCTCCTCACATCCCAGATGATGG - Intronic
1050557140 9:6799101-6799123 GCTCCTCACGTCCCAGACGATGG + Intronic
1050571916 9:6949269-6949291 GCTCCTCACATCCCAGATGATGG + Intronic
1052259110 9:26492763-26492785 GCTCCTCACATCCCAGATGATGG - Intergenic
1052771406 9:32694140-32694162 GCTCCTCACTTCCCAGATGATGG - Intergenic
1052941834 9:34137298-34137320 GCTCCTCACGTCCCAGATGATGG - Intergenic
1053412060 9:37922367-37922389 GCTCCTCTGTTCCCAGGTTAGGG + Intronic
1053747529 9:41214848-41214870 GCTTCTCAGGAAACAGGTCATGG + Intergenic
1054359643 9:64100805-64100827 GCTCCTCACATCCCAGATGATGG - Intergenic
1054479756 9:65650520-65650542 GCTTCTCAGGAAACAGGTCATGG - Intergenic
1055133979 9:72806644-72806666 GCTCCTCACATCCCAGATGATGG + Intronic
1055242013 9:74197304-74197326 GCTCCTCACGTCCCAGACGATGG - Intergenic
1055290305 9:74775897-74775919 GCTCCTCACGACCAAGAAGAGGG - Exonic
1055934998 9:81596514-81596536 GCTCATCATGACCATGGTGAAGG + Intronic
1056152420 9:83803712-83803734 GCTCCTCACGTCCCAGACGATGG - Intronic
1056564485 9:87759436-87759458 GCTCCTCACGTCCCAGACGATGG + Intergenic
1057447997 9:95132135-95132157 GCTCCTCTGGACCCAGCTGCGGG + Intronic
1057630565 9:96716053-96716075 GCTCCTCACATCCCAGATGATGG + Intergenic
1057674890 9:97130708-97130730 GCTCCTCACATCCCAGATGATGG + Intergenic
1057838235 9:98464209-98464231 GCTCCTCACATCCCAGATGATGG - Intronic
1058244248 9:102603731-102603753 GCTCCTCACATCCCAGATGATGG + Intergenic
1058244267 9:102603807-102603829 GCTCCTCACATCCCAGATGATGG + Intergenic
1058368152 9:104234796-104234818 GCTCCTCACATCCCAGATGATGG + Intergenic
1058368162 9:104234835-104234857 GCTCCTCACCTCCCAGATGATGG + Intergenic
1059285954 9:113171732-113171754 TGGCCTCAGGAACCAGGTGAAGG + Intronic
1059355398 9:113695712-113695734 TCACCTCAAGACCCAGCTGATGG + Intergenic
1060625491 9:125108291-125108313 GCTCCTCACATCCCAGATGATGG - Intronic
1060703961 9:125781056-125781078 GCTCCTCACGTCCCAGACGATGG + Intronic
1061432916 9:130542741-130542763 GTGCAGCAGGACCCAGGTGAGGG - Intergenic
1061957395 9:133970689-133970711 TCTCCTCAGGCCCCAGGGGCAGG + Intronic
1062190813 9:135246985-135247007 GCTCCACAGGCCTCGGGTGATGG + Intergenic
1062472339 9:136712141-136712163 CATCCTGAGGACCCAGGGGAAGG + Intergenic
1062526523 9:136980110-136980132 GCTCCCCAAGACCCAGGGCAGGG + Intronic
1202783661 9_KI270718v1_random:25619-25641 GCTTCTCAGGAAACAGGTCATGG + Intergenic
1203634473 Un_KI270750v1:97547-97569 GCTCCTCACATCCCAGATGATGG + Intergenic
1185511992 X:670694-670716 GCTCCTCAGGCCCAGGGAGAGGG + Intergenic
1186046782 X:5545160-5545182 TCTCCTTATGACCCAGGTAATGG + Intergenic
1186386916 X:9119472-9119494 GATCCACAGGACATAGGTGAAGG + Intronic
1186786816 X:12963106-12963128 GCTCCTCACGTCCCAGACGATGG - Intergenic
1187601212 X:20832567-20832589 GCTCCACAGGCCCCAGGTACTGG + Intergenic
1189056936 X:37707742-37707764 GCTCCTCACATCCCAGATGATGG + Intronic
1189210128 X:39277348-39277370 GCTCCTCACGTCCCAGACGATGG - Intergenic
1189505790 X:41612158-41612180 GCTCCTCACGTCCCAGACGATGG - Intronic
1190505345 X:51120030-51120052 GCTCCTCACATCCCAGATGATGG + Intergenic
1190906746 X:54736255-54736277 GCTCCTCACATCCCAGATGACGG - Intergenic
1191637287 X:63392894-63392916 GCTCCTCATGTCCCAGACGATGG - Intergenic
1191679429 X:63825855-63825877 GCTCCTCACATCCCAGATGATGG + Intergenic
1192324759 X:70122902-70122924 GCTCCTCACATCCCAGATGATGG - Intergenic
1192352973 X:70372179-70372201 GCTCCTCACGTCCCAGACGATGG + Intronic
1192477084 X:71452597-71452619 GCTCCTCAGATCCCAGACGATGG + Intronic
1192530313 X:71877281-71877303 GCTCCTCACATCCCAGATGATGG + Intergenic
1192659014 X:73022321-73022343 GCTCCTCACAGCCCAGATGATGG + Intergenic
1192663565 X:73067790-73067812 GCTCCTCACAACCCAGACGATGG - Intergenic
1192663595 X:73067906-73067928 GCTCCTCACAACCCAGATGATGG - Intergenic
1192761232 X:74098229-74098251 GCTCCTCACATCCCAGATGATGG - Intergenic
1193132492 X:77932441-77932463 GCTCCTCACGTCCCAGACGATGG + Intronic
1193345338 X:80397466-80397488 GCTCCTCACGTCCCAGACGATGG + Intronic
1194181134 X:90713568-90713590 GCTCCTCACATCCCAGATGATGG - Intergenic
1197241883 X:124129110-124129132 GCTCCTCATGTCCCAGACGATGG + Intronic
1197735844 X:129850241-129850263 GCTCCTCACGTCCCAGACGATGG - Intergenic
1198201711 X:134426882-134426904 GCACCTCAGTACCAAGGGGAGGG + Exonic
1198476645 X:137001204-137001226 GCTCCTCACGTCCCAGACGATGG + Intergenic
1198600894 X:138283158-138283180 GCTCCTCACATCCCAGATGATGG + Intergenic
1198759535 X:140017241-140017263 GCTCCTCATTACCCAGGGGTGGG + Intergenic
1198779255 X:140216809-140216831 GCTCCTCATTACCCAGGGGTGGG - Intergenic
1200048944 X:153418304-153418326 GCTCCTCTGCGCCCTGGTGATGG + Exonic
1200952979 Y:8918433-8918455 GCTCCTCACATCCCAGATGATGG + Intergenic
1201294643 Y:12453232-12453254 GCTCCTCACTTCCCAGATGATGG + Intergenic
1201294787 Y:12453770-12453792 GCTCCTCACATCCCAGATGATGG + Intergenic
1201335731 Y:12878592-12878614 GCTCCTCACATCCCAGATGATGG - Intergenic
1202029019 Y:20552614-20552636 GCTCCTCACCTCCCAGATGATGG - Intergenic