ID: 954842733

View in Genome Browser
Species Human (GRCh38)
Location 3:53526201-53526223
Sequence GAGGGGTGACGCACATGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954842733_954842747 25 Left 954842733 3:53526201-53526223 CCAGGTCATGTGCGTCACCCCTC 0: 1
1: 0
2: 0
3: 4
4: 129
Right 954842747 3:53526249-53526271 CTAAGTTCCTGGGCTAAGAATGG 0: 1
1: 0
2: 0
3: 12
4: 149
954842733_954842743 14 Left 954842733 3:53526201-53526223 CCAGGTCATGTGCGTCACCCCTC 0: 1
1: 0
2: 0
3: 4
4: 129
Right 954842743 3:53526238-53526260 CCAACTCTACCCTAAGTTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 109
954842733_954842744 15 Left 954842733 3:53526201-53526223 CCAGGTCATGTGCGTCACCCCTC 0: 1
1: 0
2: 0
3: 4
4: 129
Right 954842744 3:53526239-53526261 CAACTCTACCCTAAGTTCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954842733 Original CRISPR GAGGGGTGACGCACATGACC TGG (reversed) Intronic