ID: 954842743

View in Genome Browser
Species Human (GRCh38)
Location 3:53526238-53526260
Sequence CCAACTCTACCCTAAGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954842739_954842743 -4 Left 954842739 3:53526219-53526241 CCCTCGACCTGGGGAGGAGCCAA 0: 1
1: 0
2: 0
3: 11
4: 134
Right 954842743 3:53526238-53526260 CCAACTCTACCCTAAGTTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 109
954842733_954842743 14 Left 954842733 3:53526201-53526223 CCAGGTCATGTGCGTCACCCCTC 0: 1
1: 0
2: 0
3: 4
4: 129
Right 954842743 3:53526238-53526260 CCAACTCTACCCTAAGTTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 109
954842740_954842743 -5 Left 954842740 3:53526220-53526242 CCTCGACCTGGGGAGGAGCCAAC 0: 1
1: 0
2: 0
3: 8
4: 101
Right 954842743 3:53526238-53526260 CCAACTCTACCCTAAGTTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 109
954842738_954842743 -3 Left 954842738 3:53526218-53526240 CCCCTCGACCTGGGGAGGAGCCA 0: 1
1: 0
2: 0
3: 18
4: 156
Right 954842743 3:53526238-53526260 CCAACTCTACCCTAAGTTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954842743 Original CRISPR CCAACTCTACCCTAAGTTCC TGG Intronic