ID: 954851016

View in Genome Browser
Species Human (GRCh38)
Location 3:53600612-53600634
Sequence ATAATAAGCAGATTAAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 641
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 592}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954851016_954851018 6 Left 954851016 3:53600612-53600634 CCACCTTTTAATCTGCTTATTAT 0: 1
1: 0
2: 3
3: 45
4: 592
Right 954851018 3:53600641-53600663 TTTCATAACTTTCTATGCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954851016 Original CRISPR ATAATAAGCAGATTAAAAGG TGG (reversed) Intronic
900012278 1:125798-125820 AAAATAAACAGATTATATGGAGG + Intergenic
900042337 1:481787-481809 AAAATAAACAGATTATATGGAGG + Intergenic
900063778 1:716776-716798 AAAATAAACAGATTATATGGAGG + Intergenic
901614136 1:10524591-10524613 ATAATGGGAAGATGAAAAGGAGG - Intronic
901664689 1:10819644-10819666 ATAAGAACCAGATTAAACGGGGG + Intergenic
901779190 1:11581749-11581771 ATTATATGCAGATTAAGGGGTGG - Intergenic
903093986 1:20951735-20951757 TTAATAACCAAATAAAAAGGGGG + Intronic
905137902 1:35814276-35814298 ATATTGAGAAGATTAATAGGAGG + Intronic
908366449 1:63428213-63428235 ATAATAATAAAATTAAAAGGAGG - Intronic
908478821 1:64516709-64516731 ATAATAAGAAGATAAAAACCTGG - Intronic
908643112 1:66247089-66247111 ATAATAAGCAACTTTAGAGGGGG - Intronic
909620485 1:77661775-77661797 ATAATCAAGAGATGAAAAGGGGG - Intronic
909650458 1:77970525-77970547 ATATTAAGCACATGCAAAGGGGG + Intronic
910126914 1:83852923-83852945 ATAATAAACAGAGAAATAGGAGG + Intergenic
910378524 1:86599762-86599784 AAAATAAGCATATGAAAAGATGG + Intergenic
910520662 1:88118486-88118508 AAAATAAGTGGGTTAAAAGGAGG + Intergenic
910566484 1:88649237-88649259 ATTAAAAGTAAATTAAAAGGGGG - Intergenic
910691134 1:89966733-89966755 ACAAAAGGCAGATTAATAGGAGG - Intergenic
910810307 1:91228938-91228960 ATAAAAACCTGATTAAAAAGTGG - Intergenic
911240082 1:95455602-95455624 ACAATAGACAGATTAATAGGAGG + Intergenic
911937993 1:104005239-104005261 ACAAAAAATAGATTAAAAGGAGG + Intergenic
912309775 1:108608713-108608735 TTAAAAAGTATATTAAAAGGTGG - Intronic
913404394 1:118473407-118473429 ATAATAAGCCGATTAGAACTTGG + Intergenic
913718903 1:121571029-121571051 ATAATAAGTAGATTTAATGATGG + Intergenic
914965523 1:152254052-152254074 ATGAGAACCAGATCAAAAGGAGG - Intergenic
915710189 1:157890089-157890111 ATAATATGCAGGTAAAAAGGTGG + Intronic
916641797 1:166737115-166737137 ATAATGATGAAATTAAAAGGAGG + Intergenic
917018834 1:170563917-170563939 ATAAAAAGCAGTATAAAATGTGG - Intergenic
917176999 1:172246338-172246360 ATATTAAATAGATTAAAAAGTGG - Intronic
917341649 1:173985846-173985868 ATAATAAGCATATGAAAGGATGG - Intronic
917558832 1:176122712-176122734 GTAATAAACATTTTAAAAGGCGG - Intronic
917569763 1:176252827-176252849 TAAATAAGCACATTAAATGGGGG + Intergenic
918471041 1:184873807-184873829 ATAAAAGACAGATTAACAGGAGG - Intronic
918604337 1:186403439-186403461 AAAATAAGCAAAGTAAAATGAGG - Intronic
919499949 1:198325418-198325440 ATAATCAGCAATTTAAATGGGGG + Intergenic
919596086 1:199564112-199564134 AAAAAGAGAAGATTAAAAGGAGG + Intergenic
920606761 1:207396441-207396463 ATTATATGCAAATTAAAGGGTGG + Intergenic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
921338970 1:214115426-214115448 AAAATAAACAGTTTAAAAAGAGG + Intergenic
921662919 1:217828755-217828777 AAAATAAGCCAATTAAAAAGTGG + Intronic
922017893 1:221670691-221670713 ACAATTAGCAGCTTGAAAGGTGG + Intergenic
922260708 1:223942272-223942294 AAAATAAACAGATTATATGGAGG + Intergenic
922736361 1:227983461-227983483 AAAATAAACAGATTATATGGAGG - Intergenic
922927878 1:229365580-229365602 ATAATAAAAAAATAAAAAGGTGG - Intergenic
923387285 1:233477651-233477673 AAAAAAAACAGATTAATAGGAGG - Intergenic
923743590 1:236679349-236679371 AAAATAAGCATATGAAAAGATGG - Intergenic
923945055 1:238875733-238875755 CTAAAAAGCACATTAAAAGTAGG - Intergenic
923998377 1:239522539-239522561 ATAATAATCACACCAAAAGGTGG - Intronic
924083968 1:240429387-240429409 ACAATAAGGAGATGAAAAGACGG - Intronic
924111683 1:240705908-240705930 ATAATAAACAGCCTTAAAGGTGG + Intergenic
924288157 1:242509428-242509450 ATAATGAGCAGTGTACAAGGAGG - Intronic
924735019 1:246748041-246748063 ATAACAAGAAAATTGAAAGGGGG - Intronic
924929881 1:248721163-248721185 ATAATAATCTGATTTAAAAGTGG + Intronic
1063150617 10:3333141-3333163 ACAATAGGCAGATTAACAGGAGG + Intergenic
1063479839 10:6365683-6365705 ATAAAAGGCAGATTAACAAGAGG + Intergenic
1063594646 10:7423103-7423125 AGAAGAAGCAGAAGAAAAGGAGG + Intergenic
1063837224 10:10029566-10029588 ATAATAATCCCATTAAAAGTGGG + Intergenic
1063978609 10:11436381-11436403 AAAACAAGGAGATAAAAAGGTGG - Intergenic
1064305327 10:14160603-14160625 ATAATAATCCCATTAAAATGTGG + Intronic
1064818598 10:19297354-19297376 ATAATCATAAGATTAAAAGAGGG + Intronic
1065450809 10:25854910-25854932 AAAATCAGCATATTAAAAAGAGG + Intergenic
1065802417 10:29364920-29364942 TTAATAAAAAGATTATAAGGAGG - Intergenic
1066402794 10:35091505-35091527 AGAATCACTAGATTAAAAGGGGG - Intergenic
1066734596 10:38461082-38461104 AAAATAAACAGATTATATGGAGG - Intergenic
1067308326 10:45088166-45088188 ATAATATTAAGAATAAAAGGAGG - Intergenic
1068207774 10:53879380-53879402 ATAATAAGATGCTTATAAGGAGG + Intronic
1068276596 10:54806873-54806895 TTAATAAGCAGTTTAAAACATGG + Intronic
1068604229 10:58988070-58988092 ATAATAAGCAGGTAATAAGGAGG + Intergenic
1069186964 10:65435742-65435764 ATAAGAAGAAAAATAAAAGGAGG - Intergenic
1071262139 10:83929958-83929980 ATAATAAGCATATTGGAGGGAGG - Intergenic
1072174360 10:92902233-92902255 ATAATTTCCAGATTAAAAGAAGG - Intronic
1072270570 10:93772569-93772591 ATAATAAGCAAATGAAAAGAAGG + Intronic
1072569328 10:96644730-96644752 ATAATAAGCAGATTTTTTGGGGG - Intronic
1072727009 10:97820765-97820787 ATAATATGAAAACTAAAAGGAGG - Intergenic
1073119080 10:101110695-101110717 ATAATAATAATAATAAAAGGAGG + Intronic
1073249318 10:102112191-102112213 AAAGTATGTAGATTAAAAGGGGG - Intronic
1073826237 10:107325637-107325659 CCAATAAGCACATTAAAATGTGG - Intergenic
1073921085 10:108460497-108460519 ATAATATGCATATTAACAGTGGG + Intergenic
1073994990 10:109305325-109305347 ATAATAATCCCATTAAAAAGTGG + Intergenic
1074026254 10:109638619-109638641 ATAAAAAACAATTTAAAAGGAGG - Intergenic
1074283896 10:112079892-112079914 AGAAGAAGGAGATTAACAGGAGG - Intergenic
1074859492 10:117499566-117499588 ATAATAAGCAGGTGTAAGGGGGG + Intergenic
1075735312 10:124661241-124661263 ATAGTTAGCATATTAAACGGAGG + Intronic
1076211473 10:128649723-128649745 AAAATAACCCCATTAAAAGGTGG + Intergenic
1076230362 10:128815267-128815289 CTAATGTGCAGATTTAAAGGTGG - Intergenic
1076292288 10:129355487-129355509 ATAAAAAGAAGATGAAAAAGTGG + Intergenic
1076968609 11:118002-118024 AAAATAAACAGATTATATGGAGG + Intergenic
1077825509 11:5804611-5804633 ATCATAAGAAAATTAAAAGGGGG - Intronic
1078304470 11:10170010-10170032 CTAATAATCTGATTAAAAGCTGG - Intronic
1078976910 11:16487635-16487657 AAAATACGCTGATTAAAAAGAGG - Intronic
1080022406 11:27576631-27576653 ATAATTACCAGATGAAAAGAAGG - Intergenic
1080993922 11:37578065-37578087 AAAATAATCACATTAAAACGTGG + Intergenic
1081228633 11:40556861-40556883 ATAATAAGATTATTAAAAGTTGG + Intronic
1081337376 11:41883264-41883286 ATAATAAGCTGATTTAAAAGTGG + Intergenic
1081824840 11:46039297-46039319 AGAATCAGCAGATTGAAAGTGGG - Intronic
1082189287 11:49223329-49223351 ATAATAAGCACATAAAAACTTGG - Intergenic
1082571879 11:54751578-54751600 AAAATCTTCAGATTAAAAGGAGG + Intergenic
1082674445 11:56078785-56078807 ATAGAAAGCAGAAAAAAAGGAGG - Intergenic
1082718001 11:56639224-56639246 GTATTAAGCAGTTTAAATGGGGG + Intergenic
1082718652 11:56646423-56646445 AAAATAAGCAGATTACAATGAGG - Intergenic
1083081471 11:60098578-60098600 ATAAAGAGCTGATGAAAAGGAGG - Intergenic
1083086746 11:60155803-60155825 AAAATAAAGAGATAAAAAGGAGG + Intergenic
1083387226 11:62320564-62320586 ATAATAATCTGATTAAAAGTGGG - Intergenic
1083916986 11:65753208-65753230 CTAATAATCTGATTAAAAGTGGG - Intergenic
1085571559 11:77562554-77562576 ATAATAATCTGATTAAAAAATGG - Intronic
1086022921 11:82253626-82253648 AAAATAAGCTGATTAAAAAATGG - Intergenic
1086167994 11:83801736-83801758 ATAATAAACAGAATAACATGTGG - Intronic
1086185968 11:84016211-84016233 AAAATAACCACATTAAAAAGTGG - Intronic
1086282875 11:85210950-85210972 ATAAGAATGAGATTTAAAGGGGG - Intronic
1086677234 11:89623169-89623191 ATAATAAGCACATAAAAACTTGG + Intergenic
1086850665 11:91803508-91803530 ATAATAATGACATTAAAATGAGG - Intergenic
1087290389 11:96314548-96314570 ATAATAAGCATTTTACACGGTGG + Intronic
1087918571 11:103838713-103838735 ATAGTTACCAGATAAAAAGGGGG + Intergenic
1088080050 11:105900992-105901014 ATACTATGGAGATTACAAGGGGG - Intronic
1088489773 11:110375579-110375601 ATGTAAAGGAGATTAAAAGGAGG + Intergenic
1089986919 11:122823481-122823503 ACAATACACAGATTAACAGGAGG + Intergenic
1093566402 12:20610206-20610228 AAAATAACCTGATTAAAAAGTGG + Intronic
1093595256 12:20951370-20951392 TTAATATGCACATTAAAAAGGGG + Intergenic
1093950458 12:25160227-25160249 AGAATTAGCAGATTAAAACATGG + Intronic
1095116593 12:38360477-38360499 AAATTAAGCAAATTAAAATGAGG + Intergenic
1095161597 12:38923913-38923935 TTATTAAGCAGAATAAAAAGCGG - Intergenic
1095635695 12:44430692-44430714 ATAATAAACTGATTAATAGGAGG + Intergenic
1095911901 12:47436079-47436101 ATAATAACCCCATTAAAAAGTGG + Intergenic
1097349523 12:58533208-58533230 ATAAGAAACAGGATAAAAGGAGG - Intergenic
1097546420 12:61007413-61007435 ATAAGTAGCAGTTTGAAAGGAGG - Intergenic
1098523610 12:71461477-71461499 ATAATAAATAGACTAAAAGGCGG - Intronic
1098984554 12:76997786-76997808 ATCATAAGCAGGAGAAAAGGAGG + Intergenic
1099015921 12:77344099-77344121 GTAATTAGCTGATTAAAAAGTGG - Intergenic
1099531893 12:83792590-83792612 ATAAAAAGGAGATTTAAATGGGG + Intergenic
1100694328 12:97075123-97075145 ATAAAAAGCAGCTAAGAAGGTGG - Intergenic
1100765440 12:97860016-97860038 ATAATAATCTCATTAAAAAGTGG + Intergenic
1101214218 12:102564427-102564449 ATCAAAGGCAGATTAATAGGGGG - Intergenic
1101661649 12:106771186-106771208 AGAATTAGCATATTTAAAGGTGG + Intronic
1101693897 12:107106653-107106675 ACAATAGTCAGATTAATAGGAGG + Intergenic
1102101004 12:110279108-110279130 ATAATAAATAAATTAAAAAGTGG - Intergenic
1102731874 12:115118759-115118781 TTAATAAGTAGTTTAAAAGTGGG - Intergenic
1103809082 12:123599698-123599720 AAAATAGGCAGATTAATAGGAGG + Intergenic
1104742217 12:131186288-131186310 ATAATAATCTGATTAAAACATGG + Intergenic
1105929200 13:25036386-25036408 CTATTAAGAAAATTAAAAGGTGG + Intergenic
1107109613 13:36682489-36682511 ATAATAAGCAGATGAGACAGAGG + Intronic
1107781228 13:43904487-43904509 ATAATAAGCAGAAAGTAAGGTGG - Intergenic
1108048453 13:46405740-46405762 ATTATATGCAAATTAAGAGGTGG - Intronic
1108328719 13:49362035-49362057 ATAATATGTATATTATAAGGTGG - Intronic
1108464201 13:50697986-50698008 ATAATAAGGATATTCAAAAGGGG + Intronic
1108784987 13:53888758-53888780 AAAATCAATAGATTAAAAGGAGG - Intergenic
1109139603 13:58697823-58697845 AGAAAAAGCAGATTAAAATTAGG + Intergenic
1109419011 13:62085411-62085433 ATAACATGCAGATTAAGAGGCGG - Intergenic
1109858064 13:68159471-68159493 AATATAAGCAGATTTGAAGGGGG - Intergenic
1109863544 13:68231753-68231775 ATAAGAAGGAGATTACCAGGAGG - Intergenic
1110016201 13:70407400-70407422 ATAATATGTATATAAAAAGGGGG - Intergenic
1110605120 13:77423096-77423118 ACAAAAGGCAGATTAATAGGAGG - Intergenic
1110806019 13:79755396-79755418 ATAAAAAGAACATTAAAGGGTGG + Intergenic
1112762035 13:102702309-102702331 ATAATACACACATTAAATGGAGG + Intergenic
1113230860 13:108213948-108213970 ATATTAACGAGATAAAAAGGTGG + Intronic
1114156993 14:20116016-20116038 ATAATAGGCACATTAAAAACAGG + Intergenic
1114159138 14:20143664-20143686 ATAGAAAACAGATGAAAAGGTGG + Intergenic
1114746198 14:25150140-25150162 ATGATAAACAAATTAAAAAGTGG - Intergenic
1114828969 14:26115311-26115333 TTAAAAAGTAGATTAAATGGAGG + Intergenic
1114910057 14:27181181-27181203 AGCATAAGCAGATTGAAAGAAGG - Intergenic
1115270479 14:31546191-31546213 AAAATAAGAAGATTAATAGATGG - Intronic
1115283981 14:31697407-31697429 AAAATAAATAAATTAAAAGGAGG + Intronic
1116040628 14:39682264-39682286 ATAATAAGCAATTTCAAAGAAGG + Intergenic
1116507363 14:45700765-45700787 ATAAAAAGTAGATAAAAGGGAGG - Intergenic
1116832448 14:49734983-49735005 TTAATAAGCAGACAAAAATGGGG + Intronic
1118415584 14:65532464-65532486 AAAATAAACACATTAAAAAGTGG - Intronic
1118416883 14:65548953-65548975 AAAATAAGCACATGAAAAGATGG + Intronic
1119395840 14:74325887-74325909 ATAATAAGCATAGGAAAACGAGG - Intronic
1119818479 14:77592581-77592603 AAAATAAGTAGATTAAAAATGGG - Intronic
1120131667 14:80815228-80815250 ATAATAAGTTCATTAAAAAGTGG + Intronic
1121689050 14:95862630-95862652 AAAATTAGCACATTAAAAAGAGG + Intergenic
1121853416 14:97244824-97244846 ACAATAAGCAGAATTAAATGTGG - Intergenic
1122024143 14:98862695-98862717 ATTATTAGCAACTTAAAAGGAGG + Intergenic
1202880032 14_KI270722v1_random:49040-49062 AAAATCAGCAGATTCAAAGTAGG - Intergenic
1123985930 15:25645923-25645945 AAAATAATCTGATTAAAAGATGG + Intergenic
1125044237 15:35228232-35228254 ATAATAAAAAGTTTAAAAGTTGG - Intronic
1125367523 15:38933904-38933926 ATGAAAAGCACAATAAAAGGAGG + Intergenic
1126282033 15:46964771-46964793 ATAATAAGAAGATTAGGATGGGG + Intergenic
1127022727 15:54767649-54767671 ATAATAATCTGATTAAAAATGGG + Intergenic
1127040638 15:54972489-54972511 CTAATAAGCATATAAAAAGATGG + Intergenic
1127415577 15:58754083-58754105 TTAACAAGCAGTTTAAAAGCAGG - Intergenic
1128023309 15:64412602-64412624 ATATAAGGCAGCTTAAAAGGTGG - Intronic
1128670425 15:69570703-69570725 ACAATAGGCAGATTAATAAGAGG - Intergenic
1129498347 15:76009558-76009580 ATATTAGTTAGATTAAAAGGAGG + Intronic
1129655496 15:77522062-77522084 ATAACAACCACACTAAAAGGAGG + Intergenic
1129944911 15:79530824-79530846 ATAATAGGTATATGAAAAGGTGG + Intergenic
1130399960 15:83541842-83541864 TTAATAACCAGAATAAAAGGAGG - Intronic
1130441480 15:83958903-83958925 GTAATAAGCAAAATAAAAGGAGG + Intronic
1131500016 15:92953146-92953168 ATAAAAAGCAGAATAACAAGTGG - Intronic
1131552840 15:93372840-93372862 ATAATAATCATGTTAACAGGAGG + Intergenic
1133957536 16:10458051-10458073 AAAATAAGTAGATTAAATGATGG + Intronic
1135355905 16:21768799-21768821 ATTATATGCAGATTCAAGGGTGG + Intergenic
1135454395 16:22584938-22584960 ATTATATGCAGATTCAAGGGTGG + Intergenic
1135884217 16:26290740-26290762 ATTATAAGCTGCTTAAAAGCTGG - Intergenic
1135898875 16:26436765-26436787 ATAATAAGCTGAATAAAAAATGG - Intergenic
1137224306 16:46488223-46488245 TTAATAATCTGATTAAAAAGTGG + Intergenic
1137386843 16:48049762-48049784 CTAATAAAAAGAGTAAAAGGTGG - Intergenic
1137535188 16:49316056-49316078 ATATTAAGCATATTAATAGGAGG - Intergenic
1137593020 16:49705338-49705360 GTATAAAGCCGATTAAAAGGAGG + Intronic
1137805302 16:51299043-51299065 ATCATAAGCAAATAAAATGGTGG + Intergenic
1138249139 16:55489086-55489108 ATAAAAAACAGACTAAAAGGTGG - Intronic
1138252377 16:55511390-55511412 ATATTATCCAGTTTAAAAGGTGG + Intronic
1138517677 16:57545669-57545691 AGAATATGCAGATGAAAAAGTGG - Intronic
1138972661 16:62164573-62164595 AAAATAACCACATTAAAAAGTGG - Intergenic
1139066155 16:63317420-63317442 ATATTAATCTGATTAAAATGTGG - Intergenic
1141039702 16:80662480-80662502 ATAATAAGGAGAGTAAAAGAAGG - Intronic
1141051056 16:80764134-80764156 ATAAAAAGCAGATAATAAAGTGG + Intronic
1142452068 16:90181118-90181140 AAAATAAACAGATTATATGGAGG - Intergenic
1142542342 17:669918-669940 ATAATAAAAAAATTAAAAGGTGG + Intronic
1146223416 17:31046385-31046407 ATAATCCCCAGTTTAAAAGGAGG + Intergenic
1146341573 17:32023585-32023607 ATAATCCCCAGTTTAAAAGGAGG - Intronic
1146351228 17:32096038-32096060 ATAATCCCCAGTTTAAAAGGAGG + Intergenic
1147495158 17:40908428-40908450 ATACTAAGCAAATTAACATGTGG - Intergenic
1148202624 17:45759706-45759728 AAAATAAGTAAATAAAAAGGGGG - Intergenic
1148457909 17:47820861-47820883 ATAATATGGAGATTAATTGGTGG - Intronic
1148584877 17:48770312-48770334 AAAATAAACAGATTAAGAGCTGG + Intronic
1149249135 17:54748019-54748041 CTAATAATCTGATTAAAAGTAGG - Intergenic
1149424422 17:56541372-56541394 ATAATAGTAAGATTAAAAAGAGG + Intergenic
1149622485 17:58056187-58056209 ATAATAAACAGCTCAGAAGGAGG + Intergenic
1150872125 17:68924048-68924070 AAAATAAGAAGTTTAAAAAGTGG + Intronic
1154496930 18:14968475-14968497 ATAATAACCTGATTAAAAATGGG + Intergenic
1155206249 18:23560807-23560829 AGAATAAGCAGTTAAAAAGGGGG - Intronic
1158615244 18:58981008-58981030 ATGATAAGCAGATCAAAAATAGG - Intronic
1158736017 18:60080648-60080670 AAAATAATCACATTAAAAAGTGG + Intergenic
1159243030 18:65767903-65767925 ATATTAAGCCGAATAAATGGTGG - Intronic
1159406869 18:68014638-68014660 ATAATAAACAGTTGAAAAGTAGG + Intergenic
1159572252 18:70129942-70129964 ATAATAATCCAATTAAAAGCTGG + Intronic
1160509698 18:79446499-79446521 AAGAAAAGCAGATTAAGAGGCGG - Intronic
1160645418 19:187928-187950 AAAATAAACAGATTATATGGAGG + Intergenic
1161875204 19:6903132-6903154 ATAATATGCAGATTAACAGGTGG + Intronic
1162870538 19:13582947-13582969 ATAAAAATTAAATTAAAAGGAGG + Intronic
1163198693 19:15746109-15746131 AAAATAATCAGAAGAAAAGGAGG - Intergenic
1163315899 19:16540365-16540387 AAAAAAAGCAGCTTGAAAGGAGG - Intronic
1163423430 19:17227699-17227721 ATAATAAATAAATTAAAAGAGGG + Intronic
1165886413 19:39082230-39082252 ATAATTAGAAGATTATACGGGGG + Intergenic
1166034387 19:40156877-40156899 ATAAAAAGAAGATTAGACGGGGG + Intergenic
1167032081 19:46969312-46969334 ATAATAATCATAATAAACGGAGG + Intronic
1167935449 19:52903027-52903049 ATAGTAAAAAGATTATAAGGAGG - Intergenic
1168436875 19:56325156-56325178 ATAATAAGCAAATTGCAATGGGG - Intronic
925467468 2:4120564-4120586 CTAATAACCTGGTTAAAAGGAGG - Intergenic
925560467 2:5187338-5187360 CTAATAAGCATATGAAAAGATGG + Intergenic
925767574 2:7251435-7251457 AGAAGAAGCAGAATAAAAGGGGG + Intergenic
925892158 2:8443548-8443570 ATATGAAGCAGATTTAAAGGTGG + Intergenic
926213017 2:10885418-10885440 ACAATATGCAGACTAATAGGAGG + Intergenic
926451787 2:13012840-13012862 ATAATAATCACATTCAAAAGTGG - Intergenic
926566596 2:14482382-14482404 AGAATAAGCAGAATAAAGGCTGG + Intergenic
926577964 2:14603249-14603271 ATAATGATCAGCTGAAAAGGAGG - Intergenic
928724339 2:34153802-34153824 ATACTAAGGAGATTAAAATATGG + Intergenic
929374685 2:41271285-41271307 ATCACAGGGAGATTAAAAGGCGG + Intergenic
930972523 2:57414058-57414080 ATAATAATCTGATTAAAAATGGG + Intergenic
931346435 2:61451337-61451359 ATAATAAACAGCTTAAAAATAGG + Intronic
931811024 2:65855251-65855273 TGAAAAAGCAAATTAAAAGGAGG - Intergenic
932944976 2:76218317-76218339 AGAATAAACATATTAAAAAGAGG + Intergenic
933482185 2:82871346-82871368 ATAATAATCCCATTAAAAGTGGG - Intergenic
935489151 2:103696069-103696091 ATGGAAAGCAGAATAAAAGGAGG - Intergenic
935506342 2:103908902-103908924 AAAATAAGCATATGAAAAGATGG - Intergenic
935862997 2:107354233-107354255 TTAATAAGCCCATTAAAAAGTGG + Intergenic
936733941 2:115417400-115417422 ATAATTTGCAGTTTAGAAGGGGG + Intronic
937192656 2:120119162-120119184 AAAAAAAGCACATTAAAAAGTGG - Intronic
938254040 2:129840176-129840198 AAGATAAGCAAATGAAAAGGGGG + Intergenic
938732882 2:134160156-134160178 ATAATAAAAAAATTAAAAAGTGG - Intronic
939273995 2:139976356-139976378 ATAATAACCTGATTAAAAATAGG - Intergenic
939843040 2:147211770-147211792 ATATTTTGCAGAGTAAAAGGAGG - Intergenic
939847257 2:147262470-147262492 ATAATAATCCCATTAAAAAGTGG - Intergenic
940046812 2:149418443-149418465 ATAATAAGAAGTTGAAATGGGGG + Intronic
940122873 2:150287123-150287145 ATTATATGCAAATTAAAGGGTGG + Intergenic
940228929 2:151429973-151429995 ATACAAAACATATTAAAAGGAGG - Intronic
940588977 2:155696547-155696569 ATATTAAGCAAATTAAAAAATGG - Intergenic
940631248 2:156242301-156242323 ATAATAATCTGATTAAAAAATGG - Intergenic
941557879 2:167006145-167006167 AGAATAAGTGGATTAAAATGAGG + Intronic
941821544 2:169848992-169849014 ATAATAAGCAAATTGCAATGGGG + Intronic
941984828 2:171500030-171500052 AAAATAAAAAAATTAAAAGGCGG - Intergenic
942518776 2:176781371-176781393 AAAATAAGCAAATAAAAATGGGG - Intergenic
942869663 2:180719598-180719620 ATGAAAAGCAGATGAGAAGGTGG - Intergenic
943489573 2:188533793-188533815 ATAATAACCCGATTAAAAAGTGG + Intronic
944061839 2:195578024-195578046 AGAATCAGCAGAGTAGAAGGGGG - Intronic
944072675 2:195690700-195690722 AGAATAACCAGATTAAAAAATGG - Intronic
944156759 2:196615521-196615543 ATAATAATCTGATTAAAAATGGG - Intergenic
944706149 2:202290893-202290915 AAAATAATCAGAGTAAAAAGAGG - Intronic
944843883 2:203649735-203649757 ATAATAAGCATTTTCAAATGTGG + Intergenic
944988992 2:205212857-205212879 AGAATATGAAGATTAAAAAGAGG + Intronic
946067257 2:216998638-216998660 ATTATAACCAGATGAAAGGGGGG - Intergenic
946571122 2:221025392-221025414 TTATTAAGCAGGTTAGAAGGAGG - Intergenic
946632980 2:221691542-221691564 ATACTAATCAGTTTAAAAAGAGG - Intergenic
946990173 2:225319959-225319981 ATAATAAGCAAATTACAAGTTGG - Intergenic
947209386 2:227693886-227693908 CTAATAATCAGATTAAAAATGGG + Intronic
947476280 2:230450361-230450383 AAAATTACCAGATTAAAAGCTGG + Intronic
947506251 2:230710640-230710662 ATAATAATAATAATAAAAGGTGG - Intergenic
949083494 2:242125669-242125691 AAAATAAACAGATTATATGGAGG - Intergenic
1168738648 20:168680-168702 ATAAAAACCACATTAGAAGGGGG + Intergenic
1168884050 20:1232640-1232662 AGTATAATCAGATTTAAAGGGGG + Intronic
1169102338 20:2961464-2961486 ATAACAACCAGATTAAAAATGGG - Intronic
1169374188 20:5053205-5053227 ATAAGATGCAGATAATAAGGGGG - Intergenic
1170935697 20:20807037-20807059 GTAATTAGCAAATTAAAAAGAGG + Intergenic
1171084852 20:22228446-22228468 ATAGAAAGCAAATTAAAAAGTGG + Intergenic
1172156029 20:32825346-32825368 ATATTAATCACATTAAAATGGGG + Intronic
1174162318 20:48560428-48560450 ATAAAAAGCAGCTAAAAAGCAGG + Intergenic
1174981724 20:55402862-55402884 CTAATAATCTGATTAAAAAGTGG - Intergenic
1175181576 20:57152109-57152131 AAAAAAAAAAGATTAAAAGGTGG - Intergenic
1176876468 21:14135098-14135120 ATAATAATCCAATTAAAAAGTGG + Intronic
1176881896 21:14204591-14204613 ATAATAAACCAATTAAAAAGAGG + Intronic
1177213722 21:18102504-18102526 AAATTAAGCAGAATAAAAGCAGG - Intronic
1178596194 21:33955184-33955206 AGAATAAGACTATTAAAAGGAGG + Intergenic
1178986807 21:37311902-37311924 ATTCTAATCTGATTAAAAGGTGG - Intergenic
1179004452 21:37498904-37498926 CTAATAAGCATATGAAAAGGTGG - Intronic
1179154015 21:38833950-38833972 ATAATAATCCCATTAAAAAGTGG - Intergenic
1179406699 21:41132244-41132266 ATAATTAGCTGCATAAAAGGAGG - Intergenic
1179427362 21:41292330-41292352 ATTATATGCAAATTAAAATGTGG + Intergenic
1179466399 21:41577604-41577626 CAAGTAAGCAGAGTAAAAGGAGG - Intergenic
1182179509 22:28331621-28331643 ATAAAAAGCAGAATGAGAGGAGG - Intronic
1183266099 22:36826543-36826565 AGAACAAGCAGAATAATAGGAGG - Intergenic
1183849091 22:40569092-40569114 ATAAGAAGCAGAAAATAAGGTGG + Intronic
1184222269 22:43108837-43108859 ACAATATGCTGATCAAAAGGAGG - Intergenic
949356635 3:3187801-3187823 ATTATAAAAAAATTAAAAGGAGG + Intergenic
949734268 3:7153177-7153199 AAAATAAGCAGAAACAAAGGAGG - Intronic
950250337 3:11460084-11460106 ATAATAACCAGTTTAAATGTAGG + Intronic
951102683 3:18707617-18707639 GTAATAATCAGATTAAAAATAGG + Intergenic
951178739 3:19633694-19633716 ATAATATACAGCTTAAAAGCTGG - Intergenic
951613167 3:24514812-24514834 TTACTAAGCATATTAAAAGAAGG - Intergenic
951688796 3:25373968-25373990 ATAAAAAGCAAAATAAAATGAGG + Intronic
951739382 3:25903681-25903703 ATAATCAGCAGATTAACACATGG + Intergenic
952615338 3:35264362-35264384 ATAATAAGCTTCTTAAAAGAAGG - Intergenic
953363166 3:42318663-42318685 AAAATCAGCAGATTCAAAGTAGG + Intergenic
953704579 3:45221411-45221433 CTAATAACCAGAATCAAAGGAGG - Intergenic
953967380 3:47319913-47319935 TTAATAAGCAGATTAGAACCTGG + Intronic
954851016 3:53600612-53600634 ATAATAAGCAGATTAAAAGGTGG - Intronic
955097058 3:55809612-55809634 ATAATAACCCCATTAAAAAGTGG + Intronic
955254649 3:57317994-57318016 AGAATAACCAGATTAAAAATGGG - Intronic
955914745 3:63895535-63895557 AAAATAAGCTCATTAAAAGGTGG + Intronic
956183241 3:66536857-66536879 GCAATAAGCAGTTGAAAAGGTGG + Intergenic
956253362 3:67257772-67257794 ATAATAAACTGATTAAAAAATGG + Intergenic
956615168 3:71163856-71163878 TTAAAAAACTGATTAAAAGGGGG - Intronic
957545841 3:81635648-81635670 TAAATAAGCAGGTTAAAAGTGGG - Intronic
957719541 3:83976334-83976356 TTAATAAGCAAATAAAATGGTGG - Intergenic
958022341 3:88012900-88012922 AAAATAAGCATATGAAAAGATGG + Intergenic
958566230 3:95815096-95815118 ACAATAGGCAGATCAATAGGAGG + Intergenic
959004252 3:101001798-101001820 ATAATAATCAGATTGAAAAATGG - Intergenic
959152097 3:102619815-102619837 ACAAAATGCAGATTAATAGGAGG - Intergenic
959230419 3:103642979-103643001 ATAATAAGAAGAGGAAAAGAGGG - Intergenic
959279418 3:104318842-104318864 AGAATAAACAAATTAAAAGTAGG + Intergenic
959339158 3:105106560-105106582 ATAATAAACAGAGAAAATGGAGG + Intergenic
959343306 3:105159197-105159219 ATAAATAGCAGATAAAAAAGAGG + Intergenic
959766468 3:110036224-110036246 AGAACAAGCAGAGAAAAAGGAGG - Intergenic
959935958 3:112028480-112028502 ATCATAAGCAGTTTAGAAGACGG - Intergenic
960235568 3:115278266-115278288 CTAATAATCTGATTTAAAGGGGG - Intergenic
960536495 3:118821056-118821078 ATATTAAGCAGAAAAAAAAGGGG - Intergenic
960826502 3:121791772-121791794 TTAAAAATCAGTTTAAAAGGAGG - Intronic
960852749 3:122073278-122073300 CAAATAAGCATATGAAAAGGTGG - Intronic
963868862 3:150391950-150391972 ATAGTAAGTAGATGAAAAGATGG - Intergenic
964549534 3:157871345-157871367 GTAATAACCGGATTCAAAGGGGG + Intergenic
964653406 3:159038383-159038405 AAACTAAGCAGTTTAAAAAGAGG - Intronic
964739325 3:159949105-159949127 ATAATTAACAGATGAAAAGTAGG + Intergenic
964792488 3:160465674-160465696 AGAATGAACAGATTACAAGGGGG + Intronic
965269762 3:166600285-166600307 AAAATAAGCACAATAAAATGAGG + Intergenic
965276074 3:166684372-166684394 AAAATAACCTGATTAAAAAGTGG - Intergenic
965389407 3:168086305-168086327 ATTATAAACAGATTAAAATTTGG - Intronic
966028024 3:175309817-175309839 ATGACTAGCAGATTCAAAGGAGG - Intronic
966078262 3:175965410-175965432 AGAATAACCAGCTAAAAAGGAGG + Intergenic
967230091 3:187329690-187329712 ATAATAATAAGAGTAAAAGATGG + Intergenic
968372265 3:198231598-198231620 AAAATAAACAGATTATATGGAGG - Intergenic
970001080 4:11366815-11366837 ATAATGAACAGAGGAAAAGGTGG + Intergenic
970100992 4:12522641-12522663 ATAATAAGCATATTAATTTGAGG + Intergenic
970165663 4:13235168-13235190 ATAACAATCCCATTAAAAGGTGG + Intergenic
970576409 4:17432896-17432918 ATAATAATCCCATTAAAAAGTGG + Intergenic
970711435 4:18868190-18868212 ATATTAAGCAGAGATAAAGGAGG - Intergenic
970728619 4:19076844-19076866 AGAATAAACAATTTAAAAGGTGG + Intergenic
970790248 4:19849832-19849854 AAAATAAAAAAATTAAAAGGTGG - Intergenic
970800602 4:19968682-19968704 ATAATATCTATATTAAAAGGAGG - Intergenic
971156068 4:24084278-24084300 ATAATAAGCAGATTTGGAGAAGG + Intergenic
971213833 4:24645236-24645258 ATAATAAGCAGGTAAATAGATGG + Intergenic
971311859 4:25531960-25531982 AAAATAAGAAGAAGAAAAGGAGG + Intergenic
972035909 4:34520519-34520541 ACAATGAGCAGATTAATAGGAGG + Intergenic
972066264 4:34949380-34949402 AAAACAGGCAGATAAAAAGGAGG - Intergenic
972217893 4:36917335-36917357 ACAAAAGGCAGATTAATAGGAGG - Intergenic
972468127 4:39377653-39377675 CTAATAATCAGATTAAAAAATGG - Intergenic
972571334 4:40312907-40312929 ATAATAAGTAGATAAGGAGGAGG + Intergenic
972587804 4:40454458-40454480 ATAATAAAAAAATTAAAAGGGGG - Intronic
972753204 4:42014041-42014063 CTAATAATCTGATTAAAATGTGG + Intronic
972912736 4:43838468-43838490 AAAATAATCCGATTAAAAAGTGG + Intergenic
973063054 4:45753727-45753749 ATAATAAGCATATGAAAAGATGG - Intergenic
974072995 4:57142120-57142142 ATAATAATCCCATTAAAAAGTGG - Intergenic
974684602 4:65210758-65210780 CAAATAAGCACATTAAAAAGTGG + Intergenic
974912213 4:68136562-68136584 CAAATAAGCACATTAAAAAGTGG + Intergenic
974927675 4:68321331-68321353 ATACTAAGAAAATTAAAAGCTGG + Intronic
974949831 4:68574659-68574681 TTAATGAGAAGATTATAAGGAGG - Intronic
975197791 4:71545849-71545871 ATAATAAGCACCTTGAAAGCAGG - Intronic
975458722 4:74625283-74625305 ATAATGAGCAGATAAAGACGAGG + Intergenic
976043864 4:80920940-80920962 ATAAAAGGCAGGTTAAAAGAAGG - Intronic
976568717 4:86583879-86583901 ATAATCAGGATATTACAAGGGGG - Intronic
976684747 4:87800346-87800368 AAAATAACCAGATGAAAAGATGG - Intronic
976863282 4:89691823-89691845 ATATTAAGCAAAGTAAAATGTGG + Intergenic
977092489 4:92695337-92695359 AGAATAAGAAGAATAAAAAGAGG - Intronic
977223482 4:94366677-94366699 ATAATAATCTGATTAAAAATGGG - Intergenic
977267806 4:94876947-94876969 AAAATAACCATATTAAAAGATGG + Intronic
977722765 4:100260058-100260080 ATAAGACTCAGATTAAGAGGTGG - Intergenic
977832066 4:101606349-101606371 ATTATCAGCAGATTGTAAGGGGG + Intronic
978353258 4:107842826-107842848 AAAACAAAAAGATTAAAAGGGGG - Intronic
978353814 4:107848738-107848760 AAAATAACCTAATTAAAAGGTGG - Intronic
978743749 4:112167701-112167723 ATATTAAGCAGTTTAATAGCAGG + Intronic
978748493 4:112222220-112222242 ATGAAAAGCAAATTACAAGGTGG - Intergenic
978775626 4:112503726-112503748 ATAAAAAGCAAGTTAAAATGTGG + Intergenic
978922021 4:114195532-114195554 CTAATAAGCTGATTAAAAATGGG - Intergenic
979260951 4:118644060-118644082 AAAATAAACAGATTATATGGAGG - Intergenic
979492778 4:121347954-121347976 ATAAAAAGCAGATTAAAATAAGG - Intronic
979505700 4:121494254-121494276 CTAATAAGCATATGAAAAAGTGG + Intergenic
979647056 4:123081902-123081924 ACAATAAGCATATGAAAAGATGG - Intronic
979767311 4:124477076-124477098 ATAATAAGAAAATTGAAAGAGGG - Intergenic
979776233 4:124591663-124591685 ATAATAAACAAATAAAAAGAAGG - Intergenic
980078180 4:128316109-128316131 ATATTAAGCAGATGAAATTGAGG - Intergenic
980683212 4:136190789-136190811 CTAATAATCAGATTAAAACATGG + Intergenic
981043133 4:140241570-140241592 ATAACAAACATATTCAAAGGGGG - Intergenic
981156665 4:141445299-141445321 ATTATAAGCACTCTAAAAGGCGG + Intergenic
981224833 4:142282094-142282116 AAATTAAGCAGGGTAAAAGGTGG + Intronic
981859199 4:149334427-149334449 ATACTAACCAGATTGGAAGGTGG - Intergenic
982044152 4:151425215-151425237 ATAAGAAGCACAGGAAAAGGAGG + Intronic
982530391 4:156534214-156534236 AAAAGAAGTAGATTAGAAGGAGG - Intergenic
982619242 4:157682124-157682146 ATAATAAGCAGATTTTAAATCGG + Intergenic
982901317 4:161006744-161006766 ATAGAAAGCAGATTAACATGTGG - Intergenic
983150888 4:164279253-164279275 AAAATAAACAGATTATATGGAGG + Intronic
983711296 4:170720130-170720152 ATAATAAGCTTTGTAAAAGGGGG + Intergenic
984332104 4:178336885-178336907 ACAATAACCATATTAAAAAGTGG + Intergenic
985325514 4:188764421-188764443 AAAATAAACAGATTAAAAAAGGG + Intergenic
987890293 5:23867675-23867697 ATAAGAGGAAGATGAAAAGGAGG - Intergenic
987895080 5:23934142-23934164 ATAATATGAAAATTAAACGGTGG - Intergenic
987936265 5:24469202-24469224 ATATTAACCAGAGTAGAAGGAGG + Intergenic
988286383 5:29223204-29223226 ATAATAAGCATATTACATAGGGG + Intergenic
988367881 5:30324963-30324985 ATAATAAACTGATTAAAAATGGG - Intergenic
988462206 5:31449977-31449999 ATAATAATCCCATTAAAAAGTGG + Intronic
989242731 5:39219227-39219249 ATGATAAGCAGATAAAAATGTGG - Intronic
989559597 5:42836097-42836119 AAAAAAAGCAGATTGAAAGTGGG + Intronic
989610399 5:43285398-43285420 ATAATAATCTCATTAAAAAGTGG - Intergenic
989959695 5:50397041-50397063 ATAATAAGTAGATTTAATGATGG - Exonic
990332189 5:54739127-54739149 AGGATAATCAGATTAAAAAGAGG + Intergenic
991251579 5:64567992-64568014 ATATTTTGCAGATTAAAATGTGG + Intronic
992702749 5:79357386-79357408 AAAATCAGCAGATTTAAAGTAGG + Intergenic
992953097 5:81879922-81879944 GTAATAACCAGAATAAAATGGGG + Intergenic
993175962 5:84486122-84486144 AAAATAAGCAGATTAGAGGATGG - Intergenic
993800043 5:92320966-92320988 AAAATAACCCGATTAAAAAGTGG - Intergenic
993879887 5:93349599-93349621 CTAATATGAAGATTAAAGGGTGG - Intergenic
994006663 5:94845493-94845515 ATCACAACCAGATTAAAAAGTGG + Intronic
994017481 5:94984549-94984571 ATAATAATAACATAAAAAGGAGG + Intronic
994777732 5:104056195-104056217 ATAATAATCACATCAAAAAGTGG - Intergenic
994804721 5:104429960-104429982 ATAATAAGAATATTAAGAAGGGG - Intergenic
994899996 5:105759569-105759591 ATAATACACAGATTAAGGGGTGG - Intergenic
995360807 5:111294471-111294493 AGAAGAAACAGCTTAAAAGGTGG + Intronic
995418071 5:111932611-111932633 AAAATAAACATTTTAAAAGGAGG - Intronic
996208811 5:120779240-120779262 ATAAAAAGGAAATTAAAAGGAGG + Intergenic
996599702 5:125247877-125247899 ATAATAATCTGATTAAAACTGGG - Intergenic
997065229 5:130551722-130551744 ATTATATGCAAATTAATAGGTGG - Intergenic
998108690 5:139484827-139484849 ACAAGAGGCAGATTAACAGGAGG - Intergenic
998477687 5:142435414-142435436 ATAACATGCAGATTAAAGGGCGG + Intergenic
998669559 5:144338503-144338525 ATAATAATTGTATTAAAAGGAGG + Intronic
1000032459 5:157415770-157415792 ATAATAATCACATGAAAAAGTGG + Intronic
1000646508 5:163766380-163766402 ATTATATGCAAATTAAAGGGTGG + Intergenic
1001463966 5:171945889-171945911 ATCACAAGCAGATTGGAAGGAGG - Intronic
1001796608 5:174507434-174507456 ATAAAAAGTAAAATAAAAGGGGG - Intergenic
1002731506 5:181337142-181337164 AAAATAAACAGATTATATGGAGG - Intergenic
1003650838 6:7958805-7958827 ATAAAAAGGAGAGTAAAAAGTGG - Intronic
1005220139 6:23577008-23577030 ATGATCAGCAGATGAAGAGGTGG + Intergenic
1006234944 6:32621699-32621721 ATTATATGCAAATTAAGAGGTGG + Intergenic
1006755822 6:36414447-36414469 ATATGAAGCAAATTAAAATGTGG + Intronic
1007055132 6:38875507-38875529 ATAATAGTAAAATTAAAAGGAGG - Intronic
1007348716 6:41252545-41252567 AGAATAAGTAGATGAAAAGATGG - Intergenic
1007849370 6:44788990-44789012 AAAACAAGAAGAATAAAAGGGGG + Intergenic
1008440621 6:51528179-51528201 ATATTAAGAATATTGAAAGGAGG - Intergenic
1008649785 6:53550533-53550555 ATAATAAGTACATGAAGAGGTGG - Intronic
1008855738 6:56084634-56084656 ATAATAAACAAATGAAAAGTTGG + Intronic
1008911429 6:56738214-56738236 ATAAGAAGTAGATTAGAAGTTGG - Intronic
1009758133 6:67967470-67967492 ATAATAAGCAGAATAAAATTAGG + Intergenic
1009894126 6:69726046-69726068 CTAATAACCATATTAAAAAGTGG + Intronic
1009938050 6:70256901-70256923 TTAATAGCCAGATGAAAAGGAGG + Intronic
1010183285 6:73113068-73113090 ATAATCAGCAGAATGAAAAGAGG + Intronic
1010561817 6:77360275-77360297 GTAATGAGCAGTTTAGAAGGAGG + Intergenic
1011106998 6:83793255-83793277 ATAATAACCCCATTAAAAAGTGG + Intergenic
1011411453 6:87070788-87070810 ATCATAAGCAGATTGAAGGCAGG + Intergenic
1011787025 6:90858342-90858364 ATAACCACAAGATTAAAAGGTGG + Intergenic
1011821513 6:91258289-91258311 ATAAGAAACAAATTATAAGGTGG - Intergenic
1011994038 6:93562680-93562702 ATAATAAGCAGCTTTTAAGATGG + Intergenic
1012037478 6:94161175-94161197 ATAATAATCAGATTTAAAATGGG + Intergenic
1012116589 6:95306723-95306745 ATAATAAGTAGTTTCAAGGGAGG + Intergenic
1012456047 6:99406694-99406716 ATAATAAAAAGATAAAAATGAGG + Intronic
1012613817 6:101250394-101250416 ACAATAAGCTGATTAAAAAATGG - Intergenic
1012765785 6:103365167-103365189 ATAATAATCCCATTAAAATGTGG + Intergenic
1012917668 6:105187971-105187993 AAAACAAGAAGATGAAAAGGTGG + Intergenic
1013193197 6:107821529-107821551 ATGATAATCAGATTAAAAGAGGG + Intronic
1013791845 6:113846308-113846330 AAACTAAGCAGATTTCAAGGAGG - Intergenic
1014013058 6:116498857-116498879 ATAATAAGTAGGTTAAACAGAGG - Intronic
1014164621 6:118209438-118209460 ATATTAAGCATATAAAAAGCAGG - Intronic
1015048535 6:128810203-128810225 ATAATCAGCAGAGTAAACGTGGG - Intergenic
1015172752 6:130272032-130272054 ATAAAATGCAAATTAAAAGATGG - Intronic
1015330931 6:131978304-131978326 ATGTTCAGCAGATTACAAGGTGG - Intergenic
1015380737 6:132564643-132564665 ATAATAAGCATTTAAAAAGCAGG - Intergenic
1016063235 6:139652058-139652080 AAAATAAGCCTCTTAAAAGGTGG - Intergenic
1016204135 6:141452609-141452631 ATAACATCCAGATTAAAGGGTGG + Intergenic
1016208402 6:141498959-141498981 AAAATAAGCAAATTAAAAAGAGG + Intergenic
1016327071 6:142914988-142915010 ATAGAAAGAAGATTAAATGGGGG - Intronic
1016688566 6:146909373-146909395 ATAATGTGCAGATTATAAGTGGG - Intergenic
1017736486 6:157369511-157369533 ATTACATGCAGATTAAAGGGTGG - Intergenic
1017991903 6:159496856-159496878 AAAATAAGCAGTTCAAAAGAAGG - Intergenic
1018203615 6:161416692-161416714 ATATTAATAAGATTAAAAGCTGG - Intronic
1019472567 7:1229399-1229421 TTAATTAGCAAATTAATAGGCGG - Intergenic
1020600018 7:10262825-10262847 ATCGAAAGAAGATTAAAAGGAGG + Intergenic
1020730959 7:11879463-11879485 CTAATAATCTGATTAAAAGATGG + Intergenic
1020932904 7:14422015-14422037 ATAATAAGCATATTTATAGAAGG + Intronic
1022541538 7:31140474-31140496 CTAATAAGCCAATTAAAAGATGG - Intergenic
1022771426 7:33476941-33476963 ATAAAAAGAAGTTTAAAAGTTGG + Intronic
1023167818 7:37360300-37360322 ATAATAAGCTCATTAAATGCTGG - Intronic
1023588111 7:41751941-41751963 ATAAAAGGCAGATTAATAAGGGG - Intergenic
1024781227 7:52852230-52852252 ATAAGAAGTAGAGGAAAAGGGGG - Intergenic
1024933026 7:54684468-54684490 ATAATAATCCCATTAAAAAGTGG + Intergenic
1026180979 7:68040675-68040697 ACAATAAGCATTTTTAAAGGAGG - Intergenic
1026318319 7:69246735-69246757 ATCATGAGCAGTTTAAATGGCGG - Intergenic
1026965623 7:74437682-74437704 GTAATAAGAAGATTAATAAGAGG - Intergenic
1027565422 7:79786142-79786164 ATAAAAAACAGATTAAAAATGGG + Intergenic
1028012931 7:85672129-85672151 AGAATATGCAGATTATAAAGAGG - Intergenic
1028072555 7:86469720-86469742 ATAACCAGCAAATTAAAGGGAGG - Intergenic
1028391078 7:90317730-90317752 AGAATAAGCTGAATTAAAGGAGG - Intergenic
1028532854 7:91857614-91857636 AAAATAATCCCATTAAAAGGGGG + Intronic
1028684655 7:93577815-93577837 AAAATAAGCATCTTAAAATGTGG + Intergenic
1028783292 7:94762518-94762540 AAAATGAGCAGATAAAAAGTTGG - Intergenic
1028950915 7:96633417-96633439 AAAATAAGTAGATTAAAAGAAGG - Intronic
1029947593 7:104549595-104549617 ATAATTGGCAGATAACAAGGAGG + Intronic
1030035744 7:105406904-105406926 CTAATAAGCTGATTAAAAAATGG + Intergenic
1030133738 7:106225797-106225819 TTAAAAAGGAGATTAAAAGAAGG + Intergenic
1030485519 7:110162141-110162163 ATTACAAGGAGATTGAAAGGTGG + Intergenic
1030712896 7:112773269-112773291 ACAATAATCAAATTAAAAGCTGG + Intronic
1030740791 7:113107138-113107160 ATAATAAGCAGTTCATAAGAGGG - Intergenic
1031412300 7:121454728-121454750 ATAATAAAAAGTTTAAAAGTTGG - Intergenic
1031425152 7:121596145-121596167 ATAATTAGCATATTAAAAATAGG - Intergenic
1032089844 7:128905966-128905988 CCAATGAGCAGATTAAGAGGAGG - Intronic
1032092401 7:128917565-128917587 CCAATGAGCAGATTAAGAGGAGG + Intergenic
1032941739 7:136800852-136800874 AGAATAAGCATATTCAAAGATGG + Intergenic
1034004272 7:147451804-147451826 ATTGTAAGAATATTAAAAGGTGG + Intronic
1034093654 7:148386763-148386785 ATAAAAGACAGATTAACAGGTGG + Intronic
1035512008 8:197135-197157 AAAATAAACAGATTATATGGAGG + Intronic
1036953131 8:13160280-13160302 AAAATAAAAAAATTAAAAGGCGG + Intronic
1037169610 8:15875264-15875286 AGAATAAGCACATGAAAAGATGG + Intergenic
1037198760 8:16224215-16224237 ATTATATGCAAATTAAAGGGTGG - Intronic
1037218788 8:16490637-16490659 ATTATAGGCAGAATAAAAGATGG + Intronic
1037230517 8:16652341-16652363 AGAATTCACAGATTAAAAGGAGG - Intergenic
1037449965 8:19006899-19006921 ATACTAGGCAGATTCAAAGAGGG + Intronic
1038392425 8:27215073-27215095 ATCATAACCAGATTCAAATGTGG + Intergenic
1039640427 8:39214517-39214539 CTAATAATCTGATTTAAAGGTGG - Intronic
1039675932 8:39667079-39667101 ATAATAAACATATAAAAATGAGG + Intronic
1040725439 8:50377071-50377093 ATAATAAGCACATAGAAAGGAGG + Intronic
1040773656 8:51011826-51011848 ATAAAAACCTGATTAAAAGGTGG - Intergenic
1040932914 8:52753923-52753945 AAAATCAGCAGATTCAAAGTAGG + Intergenic
1041044123 8:53875938-53875960 AAATTATGCAGATTGAAAGGTGG - Intronic
1041065496 8:54078883-54078905 ATAAAAAGCAAAAAAAAAGGGGG - Intronic
1041218707 8:55627541-55627563 AGTATAAGCAGTTTAAAAGAGGG - Intergenic
1041283421 8:56234871-56234893 AGAATAAGCAGCTTATAAAGAGG - Intergenic
1041285316 8:56254836-56254858 ATAATAATCCGATTAAAACATGG + Intergenic
1041577220 8:59412664-59412686 ATAATAATTCCATTAAAAGGTGG - Intergenic
1041628376 8:60057110-60057132 ATATTTAGCTGATTGAAAGGAGG - Intergenic
1042886047 8:73553169-73553191 AGAATAAGCAGTTTGAAATGTGG - Intronic
1043116492 8:76260683-76260705 ATAATAATCCCATTAAAAAGTGG + Intergenic
1043806498 8:84678598-84678620 ATGATAAGGAATTTAAAAGGAGG + Intronic
1044059814 8:87622178-87622200 ATAATATGCAGTTTACAAGTTGG - Intergenic
1044096569 8:88073263-88073285 ATAATAAGCATATAAAAAAGTGG - Intronic
1044389947 8:91638417-91638439 AAAATAATCATAATAAAAGGTGG - Intergenic
1045129128 8:99128528-99128550 CTGAAAAGCAGATGAAAAGGTGG - Intronic
1045991307 8:108311762-108311784 CTAATAATCAGATTAAAAAATGG + Intronic
1046056045 8:109080473-109080495 ATAAGAAGCAAATTGGAAGGTGG + Intergenic
1046388447 8:113535384-113535406 ATAATAAACAGAATGAGAGGAGG - Intergenic
1046451304 8:114394183-114394205 ATAAGAACCACATTAAAAAGTGG + Intergenic
1047481849 8:125291098-125291120 ATATTAAGAAAGTTAAAAGGGGG + Intronic
1047657024 8:126989053-126989075 ATAATAATCCCATTAAAAAGTGG - Intergenic
1047936378 8:129784405-129784427 CTAATAATCAGATTAAAATATGG + Intronic
1047943804 8:129853668-129853690 GTAATAAACAGCTTAAGAGGAGG + Intronic
1048399370 8:134049616-134049638 ATAATACTCACATTAAAATGGGG + Intergenic
1048695708 8:137025529-137025551 ATAATAAGCAGAGAGAAGGGTGG + Intergenic
1048935530 8:139352441-139352463 ATAATGGGCAGATTACATGGGGG - Intergenic
1051118046 9:13719936-13719958 ATAATAAGGAGATTGCTAGGGGG + Intergenic
1051500626 9:17773095-17773117 CTAAAAAGCACATAAAAAGGTGG - Intronic
1051917749 9:22228905-22228927 ACAATTAGAAGATAAAAAGGCGG + Intergenic
1052164471 9:25307662-25307684 ATTATAAATAGATTAAAAGCAGG - Intergenic
1052305104 9:26999749-26999771 AGAATAAACAGATTCAAAAGAGG - Intronic
1053399865 9:37809524-37809546 ATAATATTCAGAATAAAAAGAGG + Intronic
1054902711 9:70386886-70386908 AAAATAAGCAGATTATAACGTGG + Exonic
1055119598 9:72643149-72643171 AAAAAAGGCAGAATAAAAGGAGG - Intronic
1055536598 9:77253285-77253307 TAAATAACCAGATTAAAAGATGG - Intronic
1055677528 9:78680045-78680067 ATAATATGAAGGTTAAAATGAGG + Intergenic
1056005891 9:82270830-82270852 AAAATAAGCAGATGAAAAACAGG + Intergenic
1056032991 9:82572447-82572469 ATAAAAAGCAGAATGAAGGGTGG - Intergenic
1056055331 9:82817042-82817064 ACAATAGGCAGATTAACAGGAGG - Intergenic
1059287832 9:113191573-113191595 GTGATATGCAGATTAAAATGAGG + Intronic
1059958054 9:119538609-119538631 ATAATAAGGACACTAAAAGAAGG + Intergenic
1060151830 9:121293809-121293831 AGAATAAGCACATATAAAGGAGG - Intronic
1060717598 9:125947570-125947592 AAAATAAGCAGTCTAAAAGATGG + Intronic
1060926014 9:127455717-127455739 ATAAGAAGCAGAGAGAAAGGAGG - Intronic
1061047019 9:128171129-128171151 ATAATAAATAAATAAAAAGGGGG + Intronic
1062139876 9:134950081-134950103 ATTACAAGCAGATTAAGGGGTGG + Intergenic
1062755911 9:138289652-138289674 AAAATAAACAGATTATATGGAGG - Intergenic
1186096572 X:6108926-6108948 ATAAGAATGAGATTAAAATGAGG - Intronic
1187180993 X:16943949-16943971 ATAATAATCCCATTAAAAAGTGG - Intergenic
1187650295 X:21395105-21395127 GTAATAAGAAAATTAAAAGCTGG - Intronic
1187786873 X:22901042-22901064 AAAATAATCAGATTAAAAAATGG - Intergenic
1188205872 X:27357787-27357809 AAAATAAGAAGATAAAAAAGGGG + Intergenic
1188339341 X:28979395-28979417 CTAATAACCAGAATAAAACGGGG - Intronic
1188388256 X:29588664-29588686 ATAACAAGAAGATTATTAGGAGG + Intronic
1188617025 X:32169866-32169888 ATAATATGCACATTATAAGTGGG - Intronic
1188913797 X:35884539-35884561 CTAATAAGCACATGAAAAGTTGG - Intergenic
1189424534 X:40886041-40886063 ATAGTACGCAGATTAGAAAGGGG - Intergenic
1189772594 X:44441348-44441370 ATGATAATCAGATTTATAGGAGG + Intergenic
1189772912 X:44444030-44444052 ATGATAATCAGATTTATAGGAGG + Intergenic
1189844614 X:45122795-45122817 ATAATAATCAGATTAAAAAGCGG - Intergenic
1190193912 X:48300664-48300686 ATAAAAAGTAGATTAAGAGCGGG - Intergenic
1190271004 X:48863577-48863599 ATAATAATTTGATTAAAAAGTGG + Intergenic
1190660424 X:52649323-52649345 ATAAAAAGTAGATTAAGAGCGGG - Intronic
1191078023 X:56476589-56476611 ATACTAAGCAAACTAAAATGTGG - Intergenic
1191082718 X:56530698-56530720 ATAATAAGCAAATAAAAAAATGG + Intergenic
1191152443 X:57234357-57234379 ATAATAAATAGTTTAAAAGTGGG - Intergenic
1191783759 X:64895559-64895581 CTAATAAGCATATTTAAAGATGG - Intergenic
1191829348 X:65399342-65399364 ATAATAAGCAGATTTTAAAATGG + Intronic
1192312677 X:70029592-70029614 ATAAGAAGCTAATTTAAAGGTGG - Intronic
1192415482 X:70976320-70976342 ATATGAAGCAGACTAAAATGTGG + Intergenic
1192763516 X:74120434-74120456 ATAATATACAGATTGAAAGGGGG + Intergenic
1193254234 X:79327328-79327350 AAAATAAACAGATCAAAAGGTGG - Intergenic
1193384272 X:80852026-80852048 ATAAAGAGAAAATTAAAAGGTGG - Intergenic
1193510919 X:82398394-82398416 TGAATAAGCACATGAAAAGGTGG - Intergenic
1193715556 X:84931840-84931862 ATAATAATCACATTAGAAAGTGG + Intergenic
1193732672 X:85120062-85120084 TTACTAGGCAGTTTAAAAGGAGG - Intergenic
1193814536 X:86089141-86089163 ATAATAATCACATCAAAAAGTGG + Intergenic
1194147783 X:90283605-90283627 ATAAACAGCAGATTTAAAGCAGG - Intergenic
1194371369 X:93077115-93077137 CAAATAAGCATATTAAAAGTTGG + Intergenic
1196758916 X:119182115-119182137 AAAAGAAGAAGATTCAAAGGTGG + Intergenic
1196883143 X:120218247-120218269 ATAATAATCTGATTAAAAATGGG + Intergenic
1197252584 X:124230888-124230910 TTAATTAGCATTTTAAAAGGAGG - Intronic
1197346537 X:125330266-125330288 ATAATAAGGGGTATAAAAGGTGG + Intergenic
1197661091 X:129173346-129173368 CTAATAATCTGATTAAAAAGTGG - Intergenic
1197914058 X:131515349-131515371 ATAAAATGCAAATTAAAAAGAGG - Intergenic
1198430338 X:136559605-136559627 CTAATAAGCTGATTAAAAATGGG - Intergenic
1198631473 X:138643764-138643786 ATAATAAGCAGGTTAATAGGGGG - Intronic
1198973232 X:142304662-142304684 TTTATATGAAGATTAAAAGGGGG + Intergenic
1199116901 X:144003170-144003192 CTAATAACCTGATCAAAAGGTGG - Intergenic
1199217685 X:145279727-145279749 AGAAAAAGCAGATTAAAAAAAGG - Intergenic
1199441472 X:147873228-147873250 CTAATAATCAAATTAAAAGATGG + Intergenic
1200272836 X:154702727-154702749 CTAATAATCTGATTAAAAGATGG + Intronic
1200494170 Y:3860364-3860386 ATAAACAGCAGATTTAAAGCAGG - Intergenic
1201372872 Y:13284256-13284278 TTAGTAAAAAGATTAAAAGGAGG + Intronic
1202382418 Y:24286469-24286491 AAAATAAACAGATTATATGGAGG - Intergenic
1202488366 Y:25383656-25383678 AAAATAAACAGATTATATGGAGG + Intergenic