ID: 954853326 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:53621472-53621494 |
| Sequence | TTCACCTCACTCCTCTCCCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 314 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 26, 4: 284} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 954853326_954853329 | 6 | Left | 954853326 | 3:53621472-53621494 | CCTTGGGAGAGGAGTGAGGTGAA | 0: 1 1: 0 2: 3 3: 26 4: 284 |
||
| Right | 954853329 | 3:53621501-53621523 | CAAGGCAATAAGTGTAACATAGG | 0: 1 1: 0 2: 1 3: 7 4: 106 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 954853326 | Original CRISPR | TTCACCTCACTCCTCTCCCA AGG (reversed) | Intronic | ||