ID: 954853326

View in Genome Browser
Species Human (GRCh38)
Location 3:53621472-53621494
Sequence TTCACCTCACTCCTCTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 284}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954853326_954853329 6 Left 954853326 3:53621472-53621494 CCTTGGGAGAGGAGTGAGGTGAA 0: 1
1: 0
2: 3
3: 26
4: 284
Right 954853329 3:53621501-53621523 CAAGGCAATAAGTGTAACATAGG 0: 1
1: 0
2: 1
3: 7
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954853326 Original CRISPR TTCACCTCACTCCTCTCCCA AGG (reversed) Intronic