ID: 954856429

View in Genome Browser
Species Human (GRCh38)
Location 3:53647709-53647731
Sequence CTTCATTTGTTGAATGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954856426_954856429 11 Left 954856426 3:53647675-53647697 CCTGAACGACGTTTTGCAAGATT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 954856429 3:53647709-53647731 CTTCATTTGTTGAATGTGGAGGG 0: 1
1: 0
2: 0
3: 34
4: 320
954856425_954856429 19 Left 954856425 3:53647667-53647689 CCACTTCTCCTGAACGACGTTTT 0: 1
1: 0
2: 0
3: 4
4: 78
Right 954856429 3:53647709-53647731 CTTCATTTGTTGAATGTGGAGGG 0: 1
1: 0
2: 0
3: 34
4: 320
954856424_954856429 20 Left 954856424 3:53647666-53647688 CCCACTTCTCCTGAACGACGTTT 0: 1
1: 0
2: 1
3: 8
4: 54
Right 954856429 3:53647709-53647731 CTTCATTTGTTGAATGTGGAGGG 0: 1
1: 0
2: 0
3: 34
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954856429 Original CRISPR CTTCATTTGTTGAATGTGGA GGG Intronic
900340575 1:2186808-2186830 CTTGATTTGTTAAATATTGAAGG + Intronic
905989524 1:42322490-42322512 CTTAATTTGTTGAATCTCGATGG + Intronic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
908996435 1:70161591-70161613 ATTCATTTGGTGAGTTTGGAGGG + Intronic
909278551 1:73720161-73720183 CTTCCTTAGTTTAATGTAGAGGG + Intergenic
909299403 1:73992847-73992869 CTTTATTTTTTAAATGAGGAAGG - Intergenic
910657797 1:89635464-89635486 CTTCTTATGTAAAATGTGGATGG - Intronic
912556555 1:110520423-110520445 CCTCAGTTGTGGAATGAGGAAGG + Intergenic
914447151 1:147759744-147759766 CTTCATTTATCGAATGGGGATGG + Intronic
914972075 1:152315626-152315648 ATTCATTTGTTTTATGTAGATGG - Intronic
915364690 1:155308425-155308447 CCTCATCTGTTGAATGAGGGTGG - Intergenic
915533127 1:156515518-156515540 TTTCATTTGTTTAATGAGAAGGG + Intergenic
915680622 1:157578769-157578791 CTTCAGTCGTTGTATGTTGATGG - Exonic
916356953 1:163921907-163921929 CCTCATTTCTTAAATGTGGGAGG - Intergenic
916459514 1:165008878-165008900 TGTCATTTGTGGAAAGTGGAAGG - Intergenic
916476357 1:165173204-165173226 GTCCATCTGTTGAATGTGGATGG + Intergenic
917399346 1:174629877-174629899 CTTTATTTCTTAAATATGGAAGG + Intronic
918543470 1:185656989-185657011 CTTTTTTTTTTGAATGTGCAGGG + Intergenic
919797884 1:201332250-201332272 CTTCATTCTTTGAAGGTGGGAGG - Exonic
924071529 1:240285250-240285272 CATGATGTGTTGGATGTGGAAGG + Intronic
1062769078 10:85574-85596 CTTCATTAGGTGAGCGTGGAGGG - Intergenic
1063952323 10:11234799-11234821 CTGCGTTTGTTGTCTGTGGAGGG - Intronic
1066617910 10:37314586-37314608 TTTCTTTTATTGAAGGTGGAGGG + Intronic
1067471070 10:46538290-46538312 CTTCATCTATAGAATGAGGATGG - Intergenic
1069214195 10:65798937-65798959 CAACATGTGTTGAATGTGGAGGG + Intergenic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071898982 10:90097908-90097930 CTTCATTTTTTGTATGTGTGGGG + Intergenic
1071922189 10:90363097-90363119 CTTCATTTTTTTAATCTGCAAGG + Intergenic
1072113649 10:92347691-92347713 CTTCCTATCTTGCATGTGGAAGG - Intronic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1072522817 10:96243712-96243734 CTTCTTTTATTGAATGAAGAAGG - Intronic
1072574918 10:96690682-96690704 CACCACTTGGTGAATGTGGAGGG - Intronic
1074084192 10:110195149-110195171 CTTCATTTGTTTAATGAGTATGG - Intergenic
1074432745 10:113407601-113407623 CCTCATTTGTTTAATTTGTAGGG + Intergenic
1076161755 10:128249333-128249355 CTTCATCTGTTGAATGAAGAAGG + Intergenic
1076572589 10:131442343-131442365 CTTGATTTCTTTTATGTGGACGG + Intergenic
1076648063 10:131967436-131967458 TTACATTTGGAGAATGTGGATGG - Exonic
1077481335 11:2816032-2816054 CTCCGTTAGATGAATGTGGACGG + Intronic
1078469250 11:11573882-11573904 CTTCATTTGGTGCATTTTGAGGG + Intronic
1078850196 11:15156681-15156703 CTCCATCTGTAGAATGGGGATGG + Intronic
1078896007 11:15597806-15597828 CTGCCTTTGTTGAATTGGGAGGG - Intergenic
1078974550 11:16457538-16457560 CTTCATCTGTTAAATGGGTATGG - Intronic
1081388007 11:42495910-42495932 CTTCCTTTTTTGATTGTGGCAGG - Intergenic
1082294772 11:50426628-50426650 CTGTTTTTGTTGAATCTGGAAGG + Intergenic
1085663763 11:78394368-78394390 CTTCTTTTGTGGACTGTGGAGGG - Intronic
1086878357 11:92125116-92125138 CTGCATTTGTTAAATGTTGCGGG - Intergenic
1087267945 11:96081479-96081501 CTCCATTTAATGAATGTGTATGG + Intronic
1087805665 11:102552609-102552631 CTCCATTTGTGGGTTGTGGAAGG + Intergenic
1088063214 11:105682492-105682514 GTTCCTTTGTTGTATTTGGAAGG + Intronic
1088855789 11:113752096-113752118 GCTCATTAGTTGAATCTGGAAGG + Intronic
1094447070 12:30543002-30543024 CTTCATATAATGAATTTGGAAGG + Intergenic
1095047439 12:37523437-37523459 CTTTATTTGTAGAATGTCCAAGG - Intergenic
1095076655 12:37936977-37936999 CTTTATTTGTGGCATGTGCATGG - Intergenic
1097221405 12:57453314-57453336 CTTCATGAATTCAATGTGGAGGG + Intronic
1097454669 12:59783173-59783195 TTTCATATGTAGAATGTGGAAGG + Exonic
1097872426 12:64611769-64611791 CTTCTTTTGGTGGATGTGGGAGG + Intronic
1098493150 12:71105660-71105682 CTTCCATTGTCGAATGTGGAAGG - Intronic
1100594871 12:96063027-96063049 CTTCATTGTGTGAATCTGGAGGG + Intergenic
1101627250 12:106457411-106457433 CCTCATTGGTTGAGTTTGGATGG - Intronic
1104633021 12:130420504-130420526 CTACTTTTGATGAATGTGGTTGG - Intronic
1106023288 13:25934534-25934556 CTTCATTTGGTAGATGAGGATGG - Intronic
1107371123 13:39749576-39749598 CTTCCTTTGTGGAATGTCCATGG - Intronic
1107842090 13:44468587-44468609 CTTGGTTTGTTGCAGGTGGAAGG - Intronic
1108141637 13:47428789-47428811 TTTCAGTTGTTGAATGGGGGAGG - Intergenic
1109860130 13:68187546-68187568 TTTCATTTATTGAAGGAGGATGG - Intergenic
1110585670 13:77188520-77188542 CTTCATGTGTACAATGGGGATGG + Intronic
1110782626 13:79483547-79483569 CTTGAGTTGTTGAATGTTAAGGG + Intronic
1111469145 13:88654004-88654026 CTGCATTTGTTGAAAATTGAAGG + Intergenic
1112365109 13:98749904-98749926 GCTCATTTGTTGATTGTGTACGG + Intronic
1112944708 13:104914084-104914106 CTTCATTTGGAGAATGCGGATGG - Intergenic
1115470412 14:33763107-33763129 CTTCGCTTCTTTAATGTGGAAGG + Intronic
1115908327 14:38226534-38226556 CTTTAGTTGTGGTATGTGGATGG - Intergenic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1116858790 14:49977436-49977458 CTTCATATGTCGAATCTGAAAGG + Intergenic
1117125451 14:52618562-52618584 CTTCATTTGTAGAATTTCTAGGG + Intronic
1117428941 14:55632237-55632259 CATCTTTTGTTGAAGGTGAAAGG + Intronic
1117474020 14:56075829-56075851 CTTCATTTGATGAATGACTATGG - Intergenic
1117534038 14:56687189-56687211 TTTCATTTGTAGATTATGGATGG + Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1119548365 14:75489966-75489988 CTTCATCTGTAAAATGTGGGGGG + Intergenic
1120011296 14:79418462-79418484 CTTCCTTCGATGACTGTGGATGG - Intronic
1120256526 14:82126727-82126749 CTTCATCTGTATAATGTGAATGG - Intergenic
1120598219 14:86467052-86467074 CAGCACTTGTTGAATGGGGATGG + Intergenic
1121075359 14:91063609-91063631 CTTCATATGTGTAATATGGAGGG + Intronic
1123223369 14:106877252-106877274 CCTTATTTGTTGAATTTAGATGG + Intergenic
1124683456 15:31757275-31757297 CTTCTTTTATACAATGTGGATGG + Intronic
1124822013 15:33055329-33055351 TTTCATTGGTTCAATCTGGAAGG - Intronic
1126002114 15:44220503-44220525 CTTCATTAGTAAAATGTGGGAGG + Intergenic
1126414890 15:48407150-48407172 CTTCATTTATGAAATGGGGATGG + Intergenic
1126980173 15:54232908-54232930 TTTGATGTTTTGAATGTGGAAGG + Intronic
1128749515 15:70139073-70139095 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128749649 15:70139932-70139954 CTTCATCTGTGAAATGGGGATGG + Intergenic
1129761753 15:78132850-78132872 CTCCATTTGGTGGATGGGGAAGG - Intronic
1130430933 15:83846293-83846315 CTCCATTTGTTAAATGGGGAGGG - Intronic
1131608619 15:93936767-93936789 CATCATTTGCTGATTTTGGAGGG + Intergenic
1132062004 15:98699917-98699939 CTTCAGTTATTGAATGTGTTAGG + Intronic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133616453 16:7481122-7481144 TTTCATTTGTTCAATGAGGATGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134353318 16:13458259-13458281 CCACATTTGTTGAAAGAGGAAGG - Intergenic
1134572825 16:15306254-15306276 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1134937875 16:18262124-18262146 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1135256117 16:20942745-20942767 CTTCATTTGTAGACTTAGGAGGG + Intronic
1136014724 16:27388837-27388859 CTTCATTTGTTGTTAGTTGAGGG - Intergenic
1137059874 16:35781524-35781546 CTTCATTTGTGGAATCTACAAGG - Intergenic
1137574371 16:49589044-49589066 CTTCAGTTGTTGACAGAGGAGGG - Intronic
1137673545 16:50292722-50292744 CTGCATTTGGTGCTTGTGGAAGG - Exonic
1137709450 16:50556085-50556107 CCTCAGTTGTTTAATCTGGAAGG + Intronic
1138012389 16:53394594-53394616 CTTCAATTATTAAATGTAGAAGG + Intergenic
1138041010 16:53667371-53667393 CTCCATTTGTTCAATGTTCAAGG + Intronic
1138986780 16:62338588-62338610 CTTCATAAGTAGAATGTGTAGGG - Intergenic
1140492874 16:75354665-75354687 CTTCTTTTCTTAAATGTGGTGGG + Intronic
1140581539 16:76236659-76236681 CATCATTTTTTAAATGTTGAGGG + Intergenic
1141745361 16:85922160-85922182 CTTCATTTTGAGAAGGTGGAAGG + Exonic
1144238554 17:13286907-13286929 CTTCATTGTATGAATTTGGAGGG - Intergenic
1144620991 17:16818495-16818517 CTCCATTGGGTGAATATGGACGG - Intergenic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1146094826 17:29919327-29919349 CTTCATTTATTGAGTGGGAAAGG - Intronic
1146637649 17:34518189-34518211 CTGCATCTGTTAAATGGGGATGG + Intergenic
1147493550 17:40894336-40894358 TTTCATTTGTAAAATGAGGATGG - Intergenic
1147572973 17:41582788-41582810 CTCCATTGGGTGAATATGGATGG - Intronic
1148652112 17:49257713-49257735 CTTCATTGGTTCAATGAAGATGG - Intergenic
1148976344 17:51533394-51533416 CTTCAATACATGAATGTGGAGGG - Intergenic
1149011628 17:51862954-51862976 CTTCAATACATGAATGTGGAGGG + Intronic
1150226101 17:63525255-63525277 CTTCATTTCATAGATGTGGAAGG + Intronic
1151695284 17:75712556-75712578 ATTCATGTGTTGAATGTGACAGG - Intergenic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1155297031 18:24394532-24394554 CTTGATTTGTTAAATTTGTAGGG - Intronic
1155967454 18:32049346-32049368 CATCATTTGTAAAATGGGGATGG + Intronic
1156510334 18:37631139-37631161 ATTCATTTGTTGATGGTGGAAGG + Intergenic
1157156180 18:45268712-45268734 TTTCATCTGTTGAATGGAGAAGG + Intronic
1158194099 18:54865679-54865701 CTTCTTTTGAAGAATTTGGAGGG + Intronic
1158683778 18:59594221-59594243 ATTCATTTGTAGAAGGAGGACGG - Intronic
1158870410 18:61681753-61681775 CTCCATGTGGTGAATGTAGAGGG - Intergenic
1159020864 18:63142067-63142089 CTTCATTTATTAAACGTGGAGGG + Intronic
1164366339 19:27586577-27586599 CTTCTTTTGTAGAATCTGCAAGG + Intergenic
1165359593 19:35327913-35327935 CTTCATCTGTAGGATGTGCATGG + Intronic
1166051975 19:40265860-40265882 CTTAGTTTGTTGAAGGTGGCAGG - Intronic
1168334859 19:55591997-55592019 CTTGATCTGGAGAATGTGGAGGG - Exonic
926893412 2:17658503-17658525 ATTCCCTTCTTGAATGTGGATGG - Intergenic
928329295 2:30345562-30345584 CTTCATTTTTTAAATGTGCTGGG + Intergenic
928498824 2:31865361-31865383 TCTCATTTGTAAAATGTGGAGGG - Exonic
928828313 2:35447013-35447035 CTTGAATAGTTGCATGTGGATGG - Intergenic
928883715 2:36125408-36125430 ATTCCTTTGTAGAATGTGAATGG - Intergenic
929905560 2:46043049-46043071 CTTCAAATGTTTAATTTGGATGG - Intronic
930735401 2:54773497-54773519 CTTCCTTTCTTGAATGATGAGGG - Intronic
931043211 2:58320440-58320462 ATTCATCTGTTGTATGTAGAAGG - Intergenic
931402716 2:61945726-61945748 TTACATTGGTTTAATGTGGAAGG + Intronic
931418897 2:62107427-62107449 CTCCACTTGGTGAATATGGATGG + Intronic
931496816 2:62816832-62816854 CTTCATTTGGTTTATGTGGGGGG - Intronic
931595316 2:63935893-63935915 TTTCATTTGGTGACTGAGGAAGG + Intronic
931596219 2:63947694-63947716 CTTCATTGGTTCACTGTGGTGGG - Intronic
931937783 2:67217295-67217317 CTTTATTAGTTTAATGTGTATGG - Intergenic
932043351 2:68322308-68322330 CTTCATTTGTAAAATGATGATGG + Intergenic
933616712 2:84489280-84489302 CTTCAATTGTTGAATCAGGGAGG + Intergenic
933832077 2:86219114-86219136 TTTCAGTTGTAGGATGTGGATGG - Intronic
934660823 2:96142864-96142886 CTTCCTTTTCGGAATGTGGAAGG - Intergenic
937842552 2:126538150-126538172 ATTCATTTATTGAATGTGTGAGG - Intergenic
938695554 2:133832314-133832336 CTACTTTTGTCAAATGTGGAGGG + Intergenic
939679510 2:145112904-145112926 CTTCATTTGTAAAATGTGGTTGG + Intergenic
939999697 2:148954637-148954659 GTTTGTATGTTGAATGTGGAAGG + Intronic
940633799 2:156272235-156272257 CTTCATCAGTTCAATGTGGGTGG - Intergenic
941635089 2:167927536-167927558 CTTCATTTTTAAAATGGGGATGG + Intergenic
942088073 2:172462087-172462109 CTCCAGTTGCTGAATGTGGTTGG + Intronic
943135933 2:183913063-183913085 TTTCTGTTGTTGAATGTGTAGGG - Intergenic
943863865 2:192902874-192902896 CACCATTTGTTGAATAGGGAGGG + Intergenic
944047566 2:195430365-195430387 CTTCATTCTTTGTATGTTGAAGG - Intergenic
944066087 2:195620362-195620384 CTTCATTTATTTATTGTGAATGG - Intronic
945112062 2:206369340-206369362 CCTCATTTGTGAAATGAGGAAGG + Intergenic
945812482 2:214565428-214565450 TTTCAGTTGTTGACTGAGGAGGG - Intronic
946595544 2:221302049-221302071 ACTCATTTCTTGAAGGTGGAGGG - Intergenic
1169789788 20:9397711-9397733 TTTCATTTGTTTTATGTGGCAGG + Intronic
1172025009 20:31942645-31942667 CTCCAGATGCTGAATGTGGATGG - Intronic
1172506079 20:35463689-35463711 TTTCATTTGTTGACTGAGGGAGG + Intronic
1173062668 20:39677159-39677181 GTTCATTTGTTCAACGTGAAGGG + Intergenic
1173556858 20:43972607-43972629 CCTCATCTGTTAAATGGGGATGG - Intronic
1174135455 20:48375990-48376012 CTTCTTTTGTTGATTTTGGGAGG + Intergenic
1174334242 20:49846518-49846540 CTTCATTTATTTAGTGTGGTGGG - Intronic
1177345612 21:19864846-19864868 CGTCATTTGTACAATGTAGAGGG + Intergenic
1177526031 21:22291054-22291076 TTTCATTTTGTGAATGTAGAAGG + Intergenic
1179029244 21:37705368-37705390 CCTCATTTGTTAAATGGGAATGG + Intronic
1180899222 22:19358791-19358813 CTACCTGTGTTCAATGTGGAAGG - Intronic
1181881500 22:25983949-25983971 CTTGTTTTGTTGAAGCTGGAAGG - Intronic
1181893121 22:26082380-26082402 ACTCATTTGTTAAATATGGATGG - Intergenic
1181912282 22:26248243-26248265 CTTCATCTGTAAAATGTGAATGG + Intronic
1182509051 22:30806125-30806147 CTTCATTTGTATAATAAGGATGG - Intronic
1183766665 22:39883152-39883174 ATTCATTTGTTGATTATGGAAGG - Intronic
1183795686 22:40115487-40115509 ATTCAGTACTTGAATGTGGATGG - Intronic
1184306677 22:43607670-43607692 TTTCATCTGTTCAAAGTGGAAGG - Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
949302126 3:2595924-2595946 CATCATCTGTTGTATGTGGGTGG + Intronic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
949701012 3:6757896-6757918 CTTCATTAGTACAATGTGAATGG + Intergenic
950943184 3:16915689-16915711 GTTCAGTTGATGAATTTGGAAGG - Intronic
951399365 3:22212561-22212583 CTTGATTTGTTTAATGATGAGGG - Intronic
952844837 3:37679556-37679578 CTTCATCTGTAAAATGTGAAGGG + Intronic
952959700 3:38581533-38581555 CTCATTTTATTGAATGTGGAAGG + Intronic
953227782 3:41036033-41036055 TTGCATTTGGTGAATGTAGACGG - Intergenic
953241818 3:41156128-41156150 CCTGCTTTGTGGAATGTGGATGG - Intergenic
954856429 3:53647709-53647731 CTTCATTTGTTGAATGTGGAGGG + Intronic
954915170 3:54142723-54142745 CTTCATCAGTTAAATATGGATGG - Intronic
955074218 3:55597943-55597965 CTTCTTTTGGTGCATGGGGAAGG - Intronic
956462191 3:69483867-69483889 ATTTATTTGTTGAATGTGACTGG - Intronic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
956932763 3:74064177-74064199 CTTCAATTGATGAATTTGGAAGG + Intergenic
957159842 3:76596540-76596562 CCTCATTTGTTAAATGTAGGTGG + Intronic
957353604 3:79055375-79055397 CTTCTTTCCTTGAATGTGTATGG - Intronic
957710846 3:83857766-83857788 TTTCATATGTAAAATGTGGATGG - Intergenic
957773861 3:84729873-84729895 CTTCCTGTCTTGAATGTAGAGGG - Intergenic
959789739 3:110344921-110344943 CTTCATTTCATTAATGTGAAAGG - Intergenic
960443853 3:117723195-117723217 AATCATTTGATGAATGTGAAAGG + Intergenic
961426578 3:126852965-126852987 CTTTTTTTGTTGAATGTGGCTGG + Intronic
962507930 3:136067291-136067313 TTCCATTTGTTGCAAGTGGAAGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963722725 3:148881588-148881610 CTTCCTGTGTTCAATGTTGATGG + Exonic
964569423 3:158095419-158095441 CTTCATTGGTTAAATTTAGAAGG - Intergenic
965268504 3:166581287-166581309 CTTCATGTGTTTATTTTGGAGGG + Intergenic
966493128 3:180551176-180551198 CTCCACTTGTTCAAAGTGGATGG - Intergenic
966555364 3:181253262-181253284 CAACATTTGTTGAAGGGGGAGGG + Intergenic
966703746 3:182887222-182887244 CTGTATGTGTTGCATGTGGAAGG + Intronic
967278109 3:187796081-187796103 CCTCATCTGTTGAATGATGAGGG - Intergenic
967648571 3:191957127-191957149 CATCAGTTGTTGAAAGTGCAAGG + Intergenic
967842065 3:194013799-194013821 TTTCATTTTGTGTATGTGGAAGG - Intergenic
969344961 4:6564417-6564439 CTTCGTCTGTTGCACGTGGAAGG - Intergenic
969478234 4:7433234-7433256 TTTCATTTGTGAAATGGGGATGG + Exonic
969562762 4:7960033-7960055 CTTCATTTTGTGCCTGTGGAGGG - Intergenic
970247470 4:14078404-14078426 CATCAGTTTTGGAATGTGGAAGG + Intergenic
970905425 4:21210721-21210743 CTTCATGGGCTGAAGGTGGAAGG - Intronic
971536854 4:27763318-27763340 GTTTATTTGTTGTGTGTGGAAGG - Intergenic
973267973 4:48230349-48230371 CTTCATTTGTAAAGTATGGAAGG + Intronic
974856529 4:67467414-67467436 ATTCATTTTTTGGCTGTGGATGG - Intergenic
975206797 4:71653163-71653185 GTTCATTTTTTGAAAGTTGAAGG + Intergenic
977089630 4:92653974-92653996 CTTCATATGTGGAAAGAGGATGG + Intronic
977636204 4:99301522-99301544 CTTCATCTGTACAATGTGCATGG - Intergenic
977638249 4:99325683-99325705 CTTCATCTGTAAAATGTGCATGG - Intergenic
978496662 4:109366715-109366737 CCTCATTTGGTGAATGAGGCTGG + Intergenic
978643741 4:110903342-110903364 CTTCATCTGGTTAATGTGAAAGG - Intergenic
982289465 4:153765315-153765337 CTTCATCTGTAAACTGTGGATGG - Intergenic
985533492 5:447888-447910 CGTCTTTTTTTGAACGTGGATGG + Intronic
986753130 5:10808375-10808397 CTTCACTTTTTGACTCTGGAAGG - Intergenic
987807386 5:22786638-22786660 CTTCATTTGTGTAATGGGGAAGG + Intronic
989837695 5:46013986-46014008 CTGTATTTGTAGAATCTGGAAGG + Intergenic
990458414 5:56011321-56011343 ATTCCTTTCTTGAATGTGAAGGG + Intergenic
991099612 5:62778105-62778127 CATCATTTTTTAAATGTGGTGGG + Intergenic
991313164 5:65268741-65268763 CTCCATCTGTTAAATGTGCATGG + Intronic
991636975 5:68716072-68716094 CTTGATTGGATGAATGGGGATGG + Intergenic
991993753 5:72367057-72367079 TATCATTTGATGAATCTGGAAGG - Intergenic
992673279 5:79080973-79080995 CCTCATTTCTTCCATGTGGATGG + Intronic
993153612 5:84192959-84192981 TTTCATTTGTAGGATGTAGAAGG + Intronic
994572463 5:101531802-101531824 CTTCAGTTTCTGAATTTGGAGGG - Intergenic
996364959 5:122691516-122691538 CATCATTTATTGAATGTGAAAGG + Intergenic
999983630 5:156982156-156982178 CTTTATTTGATGCATGTTGATGG - Intergenic
1000808753 5:165834325-165834347 CTTCATTTCTTAAATTTGGAAGG + Intergenic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1002163067 5:177328253-177328275 CTTCCTGTCTGGAATGTGGAAGG - Intergenic
1004025642 6:11815685-11815707 CTACATCTGTTGAAGGTGGGTGG - Intergenic
1004900295 6:20187407-20187429 ATGCATTAGTTGCATGTGGAGGG - Intronic
1005431683 6:25764205-25764227 CCTCATTTGTGGAATCTGAATGG + Intronic
1005872753 6:29987193-29987215 ATCCATTTGCTGAATTTGGAAGG - Intergenic
1006325753 6:33352557-33352579 TTGCTTTTGTTTAATGTGGACGG + Intergenic
1007154356 6:39727521-39727543 ATTCATTTGTTTAAGGTGAAGGG + Intergenic
1009427163 6:63526707-63526729 CTGCATTTCTTGAATCTGGGAGG + Intronic
1009474121 6:64066440-64066462 CTTCATTTATTTCTTGTGGAAGG - Exonic
1010306957 6:74335799-74335821 CTACATTTGTCAAATGTTGATGG + Intergenic
1013842145 6:114409340-114409362 CTTATTTTGTTGAATTTTGAGGG + Intergenic
1014080536 6:117281672-117281694 CTTTCTGTATTGAATGTGGATGG + Intergenic
1014691434 6:124568313-124568335 CTTCATTTGTTAAATTTGTAAGG - Intronic
1014872955 6:126619014-126619036 CTTCATTTTTGGAAAGAGGATGG + Intergenic
1016510592 6:144838651-144838673 CTTTATTTGTAAAATGGGGAGGG - Intronic
1016601356 6:145865177-145865199 CTTCAATAGTTGAATTTGCATGG - Intronic
1017529460 6:155274455-155274477 CATCATTAGTTGTATGTGAAAGG - Intronic
1020003824 7:4771351-4771373 ATTAAATTGTTGTATGTGGATGG + Exonic
1020438972 7:8197249-8197271 CTTCTTTTTTTTAATGTGGTTGG - Intronic
1021405148 7:20258194-20258216 CTTCAAATGTTGAATGTAGGTGG - Intergenic
1023516134 7:41003701-41003723 TTTCATTTGTTGATCTTGGATGG - Intergenic
1024233939 7:47384039-47384061 CTGCATTTGTTGAAAGTTGGTGG - Intronic
1024440522 7:49411223-49411245 CTTTATTTTCTTAATGTGGAAGG - Intergenic
1028612114 7:92723357-92723379 CTTAATTTGTGGAATGTTAAAGG - Intronic
1030362134 7:108606358-108606380 CTTCATCTGCTGAAAGTGGGGGG - Intergenic
1031745393 7:125490103-125490125 CTAAAATTGTTGAAAGTGGATGG + Intergenic
1033388251 7:140900434-140900456 CTTCATTTATTTAATATGGTAGG + Intronic
1033491197 7:141845565-141845587 CTCCAGTTGTTCAAAGTGGATGG - Intergenic
1034368295 7:150570909-150570931 CTTCAACTGTTGAATCTGGGTGG - Intronic
1034763893 7:153699506-153699528 ATTCAGTGGTTGACTGTGGATGG - Intergenic
1036451200 8:8869492-8869514 CTTTATTTCTTAAATTTGGAAGG - Intronic
1037287241 8:17314415-17314437 CTTCATTTTTAAAATGGGGAAGG + Intronic
1037309375 8:17538077-17538099 CTTTATTTGTTGAATGTCTTTGG + Intronic
1037647462 8:20805510-20805532 CCTTGTTTGTTGAACGTGGAGGG + Intergenic
1038671354 8:29585633-29585655 CTTCATTTTTTGGAGATGGAAGG - Intergenic
1038709104 8:29924580-29924602 CATCATGTATTGAATGTGTAAGG + Intergenic
1040535592 8:48306624-48306646 CTCCTTTTCTTGAATGTGTATGG - Intergenic
1040611220 8:48984060-48984082 CTTCATTTATTTAGTGTGGATGG - Intergenic
1041489212 8:58412766-58412788 CTTCATTTGTAAACTGAGGAAGG + Intronic
1041540493 8:58979394-58979416 GTTAATTTGATGAATGTGGATGG + Intronic
1041696045 8:60737466-60737488 TTTCATCTGTTAAATGAGGAGGG + Intronic
1041819208 8:62010474-62010496 CTGCATTTGCTGGATGGGGATGG - Intergenic
1042340696 8:67675690-67675712 AGTCATTTGTGGACTGTGGAGGG + Intronic
1043663406 8:82776242-82776264 CTTCATTTGTGAAATGGAGATGG - Intergenic
1044112392 8:88290910-88290932 CTTCATTTTTTGAATATTTAAGG - Intronic
1044278419 8:90328719-90328741 TTTTATTTCTTGTATGTGGATGG + Intergenic
1045147073 8:99357959-99357981 CTTCATTGGTAAAATGGGGATGG + Intronic
1047254660 8:123206504-123206526 CTCCACCTGTGGAATGTGGAGGG - Intronic
1047427595 8:124760751-124760773 CTTCATTAGTTGCATGAGAATGG - Intergenic
1047462764 8:125084172-125084194 CTTCATATTTTCCATGTGGAGGG + Intronic
1047690062 8:127342937-127342959 ATTCATTTCTTAACTGTGGAAGG - Intergenic
1048369522 8:133765571-133765593 CTTCATATGTTACATGTGGCAGG - Intergenic
1049432240 8:142570566-142570588 CATCAAGTGTTGCATGTGGAAGG + Intergenic
1050014828 9:1222454-1222476 CCTCACTTGGTGAAGGTGGAAGG - Intergenic
1050649567 9:7760736-7760758 CTACATCTGTAGTATGTGGAAGG + Intergenic
1051814925 9:21094321-21094343 CTTCATTTTATTATTGTGGAGGG - Intergenic
1052572889 9:30251044-30251066 CTTTCTTTGGTGCATGTGGATGG - Intergenic
1053446905 9:38159594-38159616 CCTCATTTGTTAAATGGGGATGG - Intergenic
1055098138 9:72435501-72435523 TTTCATATTTTAAATGTGGAAGG - Intergenic
1055159863 9:73113236-73113258 CTTCATTTGTAAATTGTTGAAGG + Intergenic
1055717337 9:79132288-79132310 TTTCTTTTGCTGAAGGTGGAAGG - Intergenic
1055797488 9:79990766-79990788 CTTTATTTGTTGAGGGTGGGTGG + Intergenic
1056222157 9:84460697-84460719 GTTCATATGTTTAATGTGGATGG + Intergenic
1056435719 9:86574385-86574407 CTTCATTTGTTGAACGAGATTGG + Intergenic
1056771161 9:89479227-89479249 CTTGATTGGTGGAATGTGGTGGG - Intronic
1056948794 9:91025352-91025374 CTTTATCTGTAAAATGTGGATGG + Intergenic
1057462535 9:95276240-95276262 CTTCATGTCTTGAATGTGAGAGG - Intronic
1057956714 9:99415342-99415364 CTTCATTTGTAGAACGAGAAGGG - Intergenic
1058793301 9:108472494-108472516 TTTGTCTTGTTGAATGTGGATGG - Intergenic
1059148339 9:111922330-111922352 TTTCATGTGATGAATTTGGAAGG + Intronic
1060011350 9:120045404-120045426 CTTCATTTATTACATGTGGCGGG - Intergenic
1060054276 9:120400496-120400518 CCTCATGTGTAGAATGCGGACGG + Intronic
1061462249 9:130749652-130749674 CTCCATCTGTTGAATGAGGCTGG + Intronic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1186087768 X:6009757-6009779 CTTCATTTTTCAAATGTGGTTGG + Intronic
1186818023 X:13257179-13257201 GTTAATTTGTTGAATGTTGTTGG - Intergenic
1187696893 X:21931641-21931663 CTTTATTTTTTCAATTTGGAAGG + Intergenic
1188572303 X:31602675-31602697 CTTCACATGCTGAATCTGGAAGG + Intronic
1188630492 X:32351935-32351957 CTTCTTTAGTTCAATGTGTAGGG + Intronic
1188823081 X:34798495-34798517 CTTTTTTCCTTGAATGTGGATGG - Intergenic
1188832483 X:34916857-34916879 CATCATTTGATGAATGCTGAAGG - Intergenic
1189298219 X:39934062-39934084 CTTCATCTGTAAAATGTGAAGGG + Intergenic
1189706491 X:43764010-43764032 CTTTATGGGTTGAGTGTGGAAGG + Intergenic
1189712297 X:43826182-43826204 CTTTATTTGTGGAATTTGGGTGG + Intronic
1189774930 X:44462092-44462114 CTTCATTGCTGGAAAGTGGAAGG + Intergenic
1190197043 X:48328707-48328729 CGTCATCTGGGGAATGTGGAGGG + Intergenic
1192170178 X:68849513-68849535 CTTCATCTGTTGAATGTAAATGG + Intergenic
1193255244 X:79341038-79341060 CTTCATATGATTGATGTGGAGGG + Intergenic
1193743698 X:85248571-85248593 GTTTATTTGTTGAATGTCAATGG - Intronic
1193809878 X:86038738-86038760 CTTCTTTTGATGAAGGTGAACGG - Intronic
1194277357 X:91901682-91901704 CTTCATTCCATGAATGTGGATGG + Intronic
1194739983 X:97560940-97560962 CTTCATATCATGAATGTAGATGG + Intronic
1195777810 X:108426987-108427009 CTACATTTGATAAATGTGGAAGG + Intronic
1196889407 X:120277605-120277627 CTTCATCTGTAAAATGTGCATGG - Intronic
1197270697 X:124422025-124422047 CTTCATTTGTTTAATAAAGATGG - Intronic
1197464564 X:126786558-126786580 TTTCATTTGTTAAATGGGGATGG + Intergenic
1197587889 X:128372126-128372148 CCTCACTTGTAAAATGTGGATGG - Intergenic
1199537903 X:148924541-148924563 CTTAATTTGATGCATGTGAATGG + Intronic
1200594696 Y:5123779-5123801 CTTCATTCCATGAATGTGGATGG + Intronic
1200861376 Y:7996217-7996239 CTTCATTCCTTGAATGTGTATGG + Intergenic