ID: 954856996

View in Genome Browser
Species Human (GRCh38)
Location 3:53652657-53652679
Sequence CACTACTACCAGTGGCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 193}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954856996_954857002 4 Left 954856996 3:53652657-53652679 CCACAGGGCCACTGGTAGTAGTG 0: 1
1: 0
2: 0
3: 15
4: 193
Right 954857002 3:53652684-53652706 ACTGGCTCTAGAGCAGGGGCTGG 0: 1
1: 0
2: 4
3: 27
4: 334
954856996_954857001 0 Left 954856996 3:53652657-53652679 CCACAGGGCCACTGGTAGTAGTG 0: 1
1: 0
2: 0
3: 15
4: 193
Right 954857001 3:53652680-53652702 CTAAACTGGCTCTAGAGCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 141
954856996_954857005 22 Left 954856996 3:53652657-53652679 CCACAGGGCCACTGGTAGTAGTG 0: 1
1: 0
2: 0
3: 15
4: 193
Right 954857005 3:53652702-53652724 GCTGGCAAACTGTGGCCAATGGG 0: 1
1: 1
2: 11
3: 86
4: 347
954856996_954857004 21 Left 954856996 3:53652657-53652679 CCACAGGGCCACTGGTAGTAGTG 0: 1
1: 0
2: 0
3: 15
4: 193
Right 954857004 3:53652701-53652723 GGCTGGCAAACTGTGGCCAATGG 0: 1
1: 0
2: 21
3: 82
4: 393
954856996_954857003 14 Left 954856996 3:53652657-53652679 CCACAGGGCCACTGGTAGTAGTG 0: 1
1: 0
2: 0
3: 15
4: 193
Right 954857003 3:53652694-53652716 GAGCAGGGGCTGGCAAACTGTGG 0: 1
1: 3
2: 29
3: 138
4: 649
954856996_954856999 -2 Left 954856996 3:53652657-53652679 CCACAGGGCCACTGGTAGTAGTG 0: 1
1: 0
2: 0
3: 15
4: 193
Right 954856999 3:53652678-53652700 TGCTAAACTGGCTCTAGAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 75
954856996_954857000 -1 Left 954856996 3:53652657-53652679 CCACAGGGCCACTGGTAGTAGTG 0: 1
1: 0
2: 0
3: 15
4: 193
Right 954857000 3:53652679-53652701 GCTAAACTGGCTCTAGAGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954856996 Original CRISPR CACTACTACCAGTGGCCCTG TGG (reversed) Intronic
900619159 1:3579076-3579098 AAACACTCCCAGTGGCCCTGGGG - Intronic
902503731 1:16926428-16926450 CACTGCCACCTGTGGCCATGGGG - Intronic
902604139 1:17559501-17559523 GACTCCTCCCAGCGGCCCTGGGG - Intronic
903133970 1:21297194-21297216 CTCAACTGCCAGAGGCCCTGGGG + Intronic
903800183 1:25961502-25961524 GACTTCAACAAGTGGCCCTGGGG + Exonic
908102977 1:60810339-60810361 CACTTCCAGCACTGGCCCTGAGG - Intergenic
908233930 1:62132420-62132442 CACTACAACCTCTGCCCCTGGGG - Intronic
908260991 1:62339112-62339134 CAGTACGGCCAGTGGCCCGGGGG + Intergenic
909384010 1:75035353-75035375 CACCACTACCCCTGGCCATGAGG - Intergenic
909667662 1:78153818-78153840 CACCACTACCCCTGGCCATGAGG + Intergenic
910547389 1:88433360-88433382 CACTGCCACCATAGGCCCTGGGG - Intergenic
917971153 1:180208673-180208695 CACTACAAACCATGGCCCTGTGG + Intergenic
919784806 1:201252331-201252353 CTCTGCTCCCAGTGGCCCTGCGG - Intergenic
921634634 1:217477592-217477614 CACTCCTACCACAGGCCATGGGG - Intronic
923009214 1:230074898-230074920 CACTGCCTCCAGAGGCCCTGAGG - Intronic
1063231137 10:4066831-4066853 ACCTACCACCAGCGGCCCTGGGG + Intergenic
1066530838 10:36337197-36337219 AACTTCTAGCAGGGGCCCTGTGG + Intergenic
1069604597 10:69731533-69731555 CACTACCACCACTGGCTCTGGGG - Intergenic
1070459726 10:76652333-76652355 CACTACTACCAGTACCCATGAGG + Intergenic
1070915074 10:80148310-80148332 CAGTACTCCCTGTGGGCCTGTGG + Intergenic
1072192596 10:93088634-93088656 CACTTCCACCAGATGCCCTGTGG - Intergenic
1074803559 10:117026278-117026300 CAGTACTCCCTGTGGGCCTGTGG + Intronic
1076701443 10:132275266-132275288 CACCCCCACCAGCGGCCCTGTGG - Intronic
1077169717 11:1160756-1160778 CCCTAAGACCAGTGGCCCTAGGG - Intronic
1081142091 11:39513995-39514017 CACTACCACCACAGGCCCGGGGG + Intergenic
1081938014 11:46918201-46918223 CGCTCCTAGCCGTGGCCCTGGGG - Intronic
1085313554 11:75530218-75530240 CACTGCCCTCAGTGGCCCTGTGG + Intergenic
1085488150 11:76886210-76886232 CAGTACTGCAAATGGCCCTGTGG + Intronic
1085770015 11:79316691-79316713 CACTTCTACCACTGCTCCTGGGG - Intronic
1086673585 11:89576302-89576324 CACTAGATCCAGTGTCCCTGGGG + Intergenic
1087380415 11:97398424-97398446 CAGTATTCCCAGTGGGCCTGTGG - Intergenic
1087598347 11:100282869-100282891 CAGTACTACCTGTGGGCTTGTGG - Intronic
1088016387 11:105065640-105065662 TACTACTACCAGTGGCTGAGAGG + Intronic
1088045802 11:105449271-105449293 CAGTACTCCCCGTGGGCCTGTGG + Intergenic
1088985234 11:114899836-114899858 CAGTACTCCCTGTGGGCCTGTGG + Intergenic
1090676858 11:129007012-129007034 CAGTACTCCCTGTGGCCCTGTGG - Intronic
1093768731 12:22995983-22996005 CCCTACTCCCAGAGGGCCTGTGG + Intergenic
1103275008 12:119704163-119704185 CGCAGCTACTAGTGGCCCTGGGG + Intronic
1103480619 12:121247850-121247872 CACTAGTCCCAGTGGGCCGGCGG - Intronic
1103720788 12:122974362-122974384 CACCACTCCCAGAAGCCCTGTGG + Intronic
1103825241 12:123732589-123732611 CTCTTCTCCCAGTGGCCATGGGG + Intronic
1104442332 12:128804006-128804028 CAGTACTGGCAGTGGGCCTGAGG - Intronic
1104760439 12:131294957-131294979 CCCTACTCTCAGTGGACCTGGGG + Intergenic
1104819340 12:131665828-131665850 CCCTACTCTCAGTGGACCTGGGG - Intergenic
1105459144 13:20567284-20567306 CACGGCTGCCAGGGGCCCTGAGG - Intronic
1105558993 13:21473055-21473077 CAGTACTCCCTGTGGGCCTGTGG - Intergenic
1110974226 13:81808724-81808746 CAGTACTCCCTGTGGGCCTGCGG + Intergenic
1112065000 13:95783670-95783692 CACCACCACCTTTGGCCCTGTGG - Intronic
1112630362 13:101154613-101154635 CACAACTCTCTGTGGCCCTGTGG + Intronic
1114498858 14:23153472-23153494 CACTACTGCCAGTGCCACTTGGG + Intronic
1116220855 14:42085526-42085548 CAGTACTCCCAGTGGGCCTGTGG - Intergenic
1117110415 14:52447270-52447292 CAGTACTCCCTGTGGGCCTGTGG + Intronic
1119681276 14:76593942-76593964 GACTTCTACCAGTGGCCCCTGGG + Intergenic
1121171668 14:91859636-91859658 CTGTATTACCAGTGCCCCTGTGG - Intronic
1122225902 14:100279385-100279407 ACCTACTAACAGTGACCCTGTGG + Exonic
1126183822 15:45811330-45811352 CACTGCTACCACTGGCTATGGGG - Intergenic
1126660674 15:51030466-51030488 CAGTACTCGCAGTGGCCCTGGGG - Intergenic
1126869482 15:52972143-52972165 CAGTTCTACCTTTGGCCCTGAGG - Intergenic
1127155707 15:56122810-56122832 CAATACTCCCTGTGGGCCTGTGG - Intronic
1131032383 15:89197083-89197105 CACACCCACCTGTGGCCCTGAGG - Exonic
1132103233 15:99043063-99043085 CATCACTTCCACTGGCCCTGTGG - Intergenic
1132553556 16:563367-563389 CACTACATCCCGCGGCCCTGGGG + Exonic
1132661787 16:1064893-1064915 CACTCCTTCCGGAGGCCCTGGGG + Intergenic
1134405154 16:13950905-13950927 CACTAATACCAGTGCCCCCCTGG + Exonic
1135879593 16:26241043-26241065 CACTGCCACCACAGGCCCTGGGG - Intergenic
1141789164 16:86221923-86221945 CCCTAGTACCTGTGGCTCTGGGG - Intergenic
1148196117 17:45714596-45714618 GACTTCTGCCAGTGACCCTGTGG + Intergenic
1148997364 17:51722853-51722875 CAGTTCTACCAGTGACCATGTGG - Intronic
1151079621 17:71313923-71313945 AACTGCTACCAGTGGCAATGTGG + Intergenic
1151818208 17:76482057-76482079 CACTCCAACCACTGGGCCTGAGG - Intronic
1152184365 17:78844791-78844813 CACCCCTTCCTGTGGCCCTGTGG + Intergenic
1152267120 17:79301665-79301687 CACTACTCCCAGTGGCCAAAAGG + Intronic
1154097338 18:11430441-11430463 CACTACTCCCCGGGGCCCGGGGG + Intergenic
1154338619 18:13485280-13485302 CACTCCTACCAGAGGCTTTGTGG - Intronic
1155282182 18:24250977-24250999 CACCACTACCACTGGCCCATGGG - Intronic
1156860907 18:41835295-41835317 CACTTCTATCAGTGCCTCTGGGG + Intergenic
1157341759 18:46784914-46784936 CACTGCAACCACTGCCCCTGGGG + Intergenic
1160806148 19:993037-993059 CACATCTACCAGTGGGCTTGGGG + Intronic
1161469948 19:4452242-4452264 CACTACTAGCAGTGGCCTCTGGG + Intronic
1161719602 19:5895639-5895661 CACTCCTCCCGCTGGCCCTGAGG + Intronic
1161800732 19:6415656-6415678 CACTACTACCAGCAGCCCCCGGG - Exonic
1164709484 19:30345197-30345219 CACTACTGACTGTGGACCTGGGG - Intronic
1167376457 19:49114670-49114692 GACTGCCACCAGCGGCCCTGCGG - Intronic
925934140 2:8736964-8736986 CAGTAATACCACTGGGCCTGGGG + Exonic
927451030 2:23209764-23209786 CCCTACCACCTTTGGCCCTGTGG + Intergenic
927594691 2:24386189-24386211 CACTACTACCACAGGCCCATGGG + Intergenic
929000974 2:37346232-37346254 CACTACCACCAGGTTCCCTGTGG - Intronic
930778309 2:55197059-55197081 CAGTACTTCCTGTGGGCCTGTGG + Intronic
930947437 2:57092392-57092414 CAGTACTCCCCGTGGGCCTGTGG - Intergenic
938089588 2:128422505-128422527 CAATACTACCTGTGGCCCACCGG - Intergenic
939483380 2:142777965-142777987 CAGTACTCCCTGTGGGCCTGTGG - Intergenic
941009104 2:160278253-160278275 AACTAGTACCACTGTCCCTGTGG - Intronic
943110391 2:183597286-183597308 CCCTACTCCCAGTGGCCGTGGGG - Intergenic
944751950 2:202718066-202718088 CAGTACTACCTGTGGGTCTGTGG - Intronic
945461605 2:210116149-210116171 CAGTACTTGCTGTGGCCCTGGGG + Intronic
945952823 2:216055722-216055744 CACTAGAGCCTGTGGCCCTGGGG - Intronic
946781480 2:223196338-223196360 GACTACTTTCAGAGGCCCTGAGG + Intronic
946864242 2:224028384-224028406 CACTACTAAGTGTGGACCTGGGG + Intronic
948635207 2:239330204-239330226 CACCACTCCCAGTGTCCCTCTGG - Intronic
1172758844 20:37307956-37307978 CACCACTTCCGGAGGCCCTGCGG - Intronic
1173137046 20:40447731-40447753 CCCTACTGCCAGTGTCCCAGGGG + Intergenic
1174192328 20:48749271-48749293 CACAGCTCCCCGTGGCCCTGTGG - Intronic
1175630770 20:60534629-60534651 CACTCCTACCAGAGGCTCTAAGG - Intergenic
1176219463 20:63963207-63963229 CAGTACCACCAGCGGCGCTGCGG - Exonic
1176350916 21:5795930-5795952 CTCTTCAACCAGTGTCCCTGGGG - Intergenic
1176357730 21:5916514-5916536 CTCTTCAACCAGTGTCCCTGGGG - Intergenic
1176545237 21:8194000-8194022 CTCTTCAACCAGTGTCCCTGGGG - Intergenic
1176564188 21:8377045-8377067 CTCTTCAACCAGTGTCCCTGGGG - Intergenic
1180140956 21:45893134-45893156 CACAACTGCCATAGGCCCTGAGG - Intronic
1183779471 22:39989523-39989545 CTCTCCTCCCAGTGGGCCTGGGG + Intergenic
1184851698 22:47124852-47124874 CTGTCCTCCCAGTGGCCCTGCGG - Intronic
1184914532 22:47560211-47560233 GACTAATACCAGGGGCCCTTGGG + Intergenic
1185058001 22:48591339-48591361 CACTCCTGCCTGTGGCTCTGAGG - Intronic
1203250107 22_KI270733v1_random:110238-110260 CTCTTCAACCAGTGTCCCTGGGG - Intergenic
951495006 3:23316396-23316418 CAGTACTCCCTGTGGGCCTGTGG - Intronic
951515928 3:23559557-23559579 AACTAATACCAGCAGCCCTGTGG + Intronic
954491669 3:50912733-50912755 CAGTACTCCCTGTGGGCCTGTGG - Intronic
954856996 3:53652657-53652679 CACTACTACCAGTGGCCCTGTGG - Intronic
955441138 3:58956393-58956415 CAGTACTCCCAGTGGGCATGAGG + Intronic
958085254 3:88798054-88798076 CAGTACTGCCTGTGGGCCTGAGG - Intergenic
959122304 3:102247174-102247196 TAGTACTATCAGTGGCCCTCTGG - Intronic
960179262 3:114555644-114555666 CACAACTGTCAGTGCCCCTGTGG + Intronic
961952347 3:130762837-130762859 TAGTACTCCCAGTGGGCCTGTGG + Intergenic
962078681 3:132114299-132114321 CACTACTACCACAGGCCCATGGG + Intronic
962400118 3:135051141-135051163 AGCTACTACCAGTGGATCTGAGG - Intronic
962698969 3:137978722-137978744 CAGTACTCCCTGTGGGCCTGTGG - Intergenic
968429104 4:544823-544845 CACCACCACCACGGGCCCTGGGG + Intergenic
969307544 4:6334565-6334587 CACTGGTAGCAGTGACCCTGGGG + Intronic
970413374 4:15833011-15833033 CAGTACTCCCTGTGGGCCTGTGG - Intronic
971588007 4:28430832-28430854 CACTACTCCTGGGGGCCCTGAGG + Intergenic
974301062 4:60067621-60067643 CATTACTCCCTGTGGGCCTGGGG + Intergenic
978116528 4:105025516-105025538 CACTGCTACCCCTGGCCATGAGG - Intergenic
978556349 4:109984944-109984966 CACAACTAACTGTGGCCTTGAGG - Intronic
979219088 4:118200333-118200355 CAGTACTCCCTGTGGGCCTGAGG - Intronic
983875789 4:172873199-172873221 CTCTTCCACCAGTGTCCCTGAGG + Intronic
984788511 4:183592102-183592124 CACCACCCCCAGTGGCCCTCAGG + Intergenic
985126630 4:186701356-186701378 CACAACTTCCAGTCTCCCTGTGG + Intronic
988141317 5:27244594-27244616 CACTGCTACCTCTGCCCCTGGGG - Intergenic
991297213 5:65093850-65093872 CATTACTCTCAGTGGGCCTGTGG + Intergenic
991663677 5:68974802-68974824 CACCACTACCCCTGGCCATGAGG - Intergenic
995096405 5:108240420-108240442 CAGTACTCCCTGTGGGCCTGTGG + Intronic
995290221 5:110443358-110443380 CACTAATACCACTGGCCCATGGG + Intronic
997462164 5:134060054-134060076 CATCACTAGCAGGGGCCCTGGGG - Intergenic
998549412 5:143063098-143063120 CCATACCACCAGTGGCCCAGCGG - Intronic
999406545 5:151312138-151312160 CATTACTCCCTGTGGGCCTGAGG - Intergenic
1002667410 5:180835342-180835364 CACTTGCACCAGTGGCCCTCTGG + Intergenic
1003035122 6:2634950-2634972 CACTACTATCACTGTCACTGGGG + Intergenic
1005506187 6:26470754-26470776 GACTTATACCAGTGGCCCTGAGG + Intronic
1006067902 6:31475540-31475562 CTCCACCACCAGTGGCGCTGTGG - Intergenic
1006963770 6:37961214-37961236 CAGTACTCCCTGTGGGCCTGAGG + Intronic
1007880382 6:45158835-45158857 CACTACTACTAGTCACCCTGAGG + Intronic
1008314743 6:50026107-50026129 CACTACTACCACAGGCCCACAGG - Intergenic
1009987326 6:70796299-70796321 CACTACTAACTGTGGTCCAGTGG - Intronic
1011733448 6:90290121-90290143 CACTACTATCTTTGGCCCTTTGG - Intronic
1011927198 6:92661084-92661106 CATTACTACAAGAGGCCATGAGG - Intergenic
1014186908 6:118445297-118445319 CACGACCACCAGTGGCCCATGGG + Intergenic
1016061539 6:139636203-139636225 CAGTACTCCCTGTGGGCCTGTGG - Intergenic
1018170478 6:161139817-161139839 CACCACTCCCAGTGTCCCTGTGG - Intronic
1019743530 7:2687649-2687671 CCCTACAGTCAGTGGCCCTGAGG - Intronic
1020236964 7:6363670-6363692 CACTACAACCTCTGCCCCTGGGG - Intergenic
1022223547 7:28339919-28339941 CAGTACTGCCCGTGGGCCTGTGG - Intronic
1027228816 7:76260716-76260738 CACTAGTGCGAGTGGCCCTGGGG + Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1028929497 7:96397410-96397432 CAGTACTCCCCGTGGGCCTGTGG - Intergenic
1030096656 7:105906633-105906655 CACCATGACCAATGGCCCTGGGG - Intronic
1033237132 7:139646928-139646950 CACCTCTGTCAGTGGCCCTGTGG + Intronic
1033833582 7:145282566-145282588 CACTGCTACCACAGGCCCTTGGG + Intergenic
1035192220 7:157180905-157180927 CAGGACTGCCAGTGACCCTGGGG + Intronic
1036416419 8:8553789-8553811 CATTTCTGCCAGTGGCCCTGGGG + Intergenic
1038583120 8:28767322-28767344 TCCTACGACCAGTGGCTCTGAGG + Intergenic
1039640750 8:39218649-39218671 CATTACTCCCTGTGGGCCTGTGG - Intronic
1040637995 8:49298240-49298262 CACAACTACCACTGGTGCTGAGG - Intergenic
1043080127 8:75755844-75755866 CAGTACTCCCTGTGGGCCTGTGG + Intergenic
1044216888 8:89622873-89622895 CTCTTCTACCAGTGGTTCTGTGG - Intergenic
1045084773 8:98670689-98670711 CAATACTACCTGTGGCCCATGGG + Intronic
1045167792 8:99626422-99626444 CCCTACTTCCTGTGACCCTGAGG - Intronic
1048989643 8:139753701-139753723 CATTACTAGCTGTGGCCCTCTGG + Intronic
1052607477 9:30723340-30723362 CAGTACTCCCAATGGGCCTGTGG + Intergenic
1057295214 9:93830624-93830646 AAATACTAACAGTGGGCCTGGGG + Intergenic
1057873588 9:98736087-98736109 CATGACTACCAGTGGCCAAGAGG + Exonic
1058950956 9:109903325-109903347 CAACCCAACCAGTGGCCCTGTGG - Intronic
1060992333 9:127856275-127856297 CATGACTCCCAGTGGCCCTAAGG - Intergenic
1203466508 Un_GL000220v1:93505-93527 CTCTTCAACCAGTGTCCCTGGGG - Intergenic
1187612916 X:20961645-20961667 CAGTACTTCCTGTGGGCCTGTGG + Intergenic
1187836266 X:23435224-23435246 CAGTACTTGCAGTGGCCCTGGGG + Intergenic
1189019642 X:37320700-37320722 CAGTACTTCCTGTGGGCCTGTGG + Intergenic
1190054853 X:47175474-47175496 CAGGACTTCCAGTGGTCCTGAGG - Intronic
1190537717 X:51446397-51446419 CACTACTCTCTGTGGGCCTGTGG - Intergenic
1191826967 X:65376153-65376175 AAATACTTCCAGTGGGCCTGTGG + Intronic
1191986321 X:66985297-66985319 CAGTACTACCCATGGGCCTGTGG - Intergenic
1192667300 X:73101483-73101505 CACTACCACCCCAGGCCCTGAGG + Intergenic
1192836162 X:74801922-74801944 CAGTACTCCCTGTGGGCCTGTGG + Intronic
1193280302 X:79641204-79641226 CACTACCACCACAGGCCATGGGG + Intergenic
1193905821 X:87243230-87243252 CAGTACTGCCTGTGGGCCTGTGG - Intergenic
1194228076 X:91286736-91286758 CAGTACTTCCTGTGGGCCTGTGG + Intergenic
1194831851 X:98632556-98632578 CATTACTCCCAGTGGGCCTGAGG + Intergenic
1196075993 X:111576865-111576887 CACTACAACCTCTGCCCCTGAGG - Intergenic
1196364683 X:114911332-114911354 CACTACTACCAGTGGAAGGGAGG + Intergenic
1196623664 X:117853200-117853222 CACTACTTCCAATGGCCATTTGG - Intergenic
1197438019 X:126456313-126456335 CACTACCACCAGAGGCCATGAGG - Intergenic
1198079025 X:133220996-133221018 CACTTCTACCACAGGCCCAGGGG - Intergenic
1198697195 X:139354730-139354752 CACTACTCCCCATGGCCCTATGG - Intergenic
1199274675 X:145926844-145926866 CAGTACTACCCATGGACCTGTGG + Intergenic
1200177410 X:154126533-154126555 CAGTACTCCCCGTGGGCCTGGGG + Intergenic
1201368592 Y:13235428-13235450 CTCAGCTCCCAGTGGCCCTGTGG + Intergenic
1202332424 Y:23768860-23768882 CACTTGTCCCAGAGGCCCTGAGG + Intergenic
1202349471 Y:23972432-23972454 CACTTGTCCCAGAGGCCCTGAGG + Intergenic
1202521304 Y:25697672-25697694 CACTTGTCCCAGAGGCCCTGAGG - Intergenic
1202538345 Y:25901203-25901225 CACTTGTCCCAGAGGCCCTGAGG - Intergenic