ID: 954860854

View in Genome Browser
Species Human (GRCh38)
Location 3:53689266-53689288
Sequence GCTGCCAGGGTGCTCCGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954860851_954860854 -3 Left 954860851 3:53689246-53689268 CCAGTGAGTGCAATGGTGAGGCT 0: 1
1: 0
2: 0
3: 16
4: 117
Right 954860854 3:53689266-53689288 GCTGCCAGGGTGCTCCGTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 191
954860848_954860854 7 Left 954860848 3:53689236-53689258 CCTGTCGGAACCAGTGAGTGCAA 0: 1
1: 0
2: 0
3: 0
4: 37
Right 954860854 3:53689266-53689288 GCTGCCAGGGTGCTCCGTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 191
954860845_954860854 21 Left 954860845 3:53689222-53689244 CCTGGTGCCTCCTGCCTGTCGGA 0: 1
1: 0
2: 1
3: 22
4: 227
Right 954860854 3:53689266-53689288 GCTGCCAGGGTGCTCCGTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 191
954860846_954860854 14 Left 954860846 3:53689229-53689251 CCTCCTGCCTGTCGGAACCAGTG 0: 1
1: 0
2: 0
3: 4
4: 126
Right 954860854 3:53689266-53689288 GCTGCCAGGGTGCTCCGTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 191
954860847_954860854 11 Left 954860847 3:53689232-53689254 CCTGCCTGTCGGAACCAGTGAGT 0: 1
1: 0
2: 0
3: 7
4: 79
Right 954860854 3:53689266-53689288 GCTGCCAGGGTGCTCCGTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954860854 Original CRISPR GCTGCCAGGGTGCTCCGTGC TGG Intronic
900186551 1:1335790-1335812 GCCCCCAGGGTGGTCCATGCGGG - Exonic
900431370 1:2604629-2604651 GGTGCCAGGGTGGTGGGTGCCGG + Intronic
900605289 1:3521119-3521141 CCTGCCAGGGTCCTCCTGGCCGG - Intronic
900612587 1:3550635-3550657 GCCTCCGGGGTGCTCCGTGCCGG + Intronic
900843455 1:5076868-5076890 GATGACAGGGTGGTCTGTGCTGG - Intergenic
901837331 1:11933002-11933024 GCTGGCAGGGGGTTCCCTGCAGG - Intergenic
901865912 1:12106617-12106639 CCTGACAGGGAGCTCCGAGCTGG + Intronic
902066789 1:13694933-13694955 GCTCCCAGCGTGCTCCGTGATGG - Intergenic
905291653 1:36925784-36925806 GAGGCAAGGGTGCTCAGTGCTGG + Intronic
905414392 1:37794406-37794428 GCCGCCAGGGTCCGCGGTGCGGG - Exonic
905685046 1:39901850-39901872 GCTGCCGGGCTGCCCCGAGCCGG - Exonic
905734696 1:40317080-40317102 GCTGCCAGGGTCCAGGGTGCGGG - Intronic
906108417 1:43308121-43308143 GCTGGCAGTGAGCTCCTTGCTGG - Intronic
908745634 1:67373842-67373864 GCTGCCAGAGAGCTGCCTGCAGG + Intronic
908959491 1:69678238-69678260 CCTGCCAGCTTGCTCCTTGCCGG + Intronic
912282205 1:108327739-108327761 GCTGCCACTGTGCCCCGTCCAGG - Intergenic
912802977 1:112732903-112732925 GCTGCCAGTGTGCCCTGGGCTGG - Intergenic
919938118 1:202268321-202268343 GGTGCCAGCCTGCTCCCTGCTGG + Intronic
921174528 1:212582606-212582628 ACTACCAGAGTGCTCAGTGCAGG - Intronic
924472026 1:244350912-244350934 GGTGACAAGGTGCTCCGTGGGGG - Intergenic
1070328340 10:75401899-75401921 GCTGCCAGGACTCTCAGTGCCGG + Exonic
1072664960 10:97385920-97385942 GCTGACAGGGTGCTCAGGCCAGG + Exonic
1073424702 10:103449438-103449460 GTTGTCAGGGTTCTCCTTGCAGG + Exonic
1076306730 10:129470608-129470630 CCTGCCAAGGTGCTCGGTCCCGG + Intronic
1076341109 10:129745370-129745392 GCTGCCAGGGGGCGGCGTGGGGG - Intronic
1077066087 11:641446-641468 GCTCCCAGGGCCCTCCATGCAGG + Intergenic
1077298390 11:1836439-1836461 GCTGCCAGGGGCCACCCTGCAGG + Exonic
1077516126 11:3003097-3003119 CCTGCCCGGGTGCTGCCTGCTGG - Intronic
1077524791 11:3057514-3057536 GCTCCCAGCATGCTCCGGGCCGG - Intronic
1080271166 11:30452197-30452219 GCAGCCAGAGTGCTGGGTGCAGG - Intronic
1081620248 11:44615111-44615133 GCTCCCAGGGTGCCCGATGCAGG - Intronic
1083171520 11:60926203-60926225 ACTGCCACGGTGCACCCTGCAGG - Intronic
1084114301 11:67032953-67032975 CCTTACAGGGTGCTCAGTGCTGG + Intronic
1084296031 11:68213773-68213795 GCTTCCACGGGGCTCTGTGCGGG + Intronic
1084358279 11:68653443-68653465 GGGGCCAGGGTCCTCAGTGCTGG + Intergenic
1084473974 11:69378360-69378382 GCTGGCCGGGTGTCCCGTGCTGG + Intergenic
1084740668 11:71137536-71137558 GCCGCCAGGGTGCTGGGTGCAGG + Intronic
1084740677 11:71137582-71137604 GGTGCCAGGGTGCTGGCTGCAGG + Intronic
1085519224 11:77128415-77128437 GCTTCCTGAGTCCTCCGTGCAGG + Exonic
1087698269 11:101406407-101406429 GCTCCCAGGGTGCCTCATGCAGG + Intergenic
1088883503 11:113989652-113989674 GCTGCGCGTGGGCTCCGTGCTGG + Exonic
1089565872 11:119371355-119371377 GCTCTCAGGGTGCTGCGTGCTGG - Intronic
1089688092 11:120169544-120169566 GCGGGCGGCGTGCTCCGTGCTGG + Intronic
1090201989 11:124863964-124863986 GCTCCCAGGGCGCTGCGTGGCGG + Intergenic
1090345084 11:126062939-126062961 GCTGCTCGCGTGCTCCGGGCCGG - Intronic
1090606350 11:128426061-128426083 CCTTCCAGTGTGCTCTGTGCAGG + Intergenic
1096489669 12:52006830-52006852 GCGGGGAGGGTCCTCCGTGCTGG + Intergenic
1096531475 12:52245329-52245351 GTTGCCCGGGTGCTCACTGCAGG + Intronic
1103497591 12:121374717-121374739 GCTGCCAAGGAGCTCAGGGCGGG - Intronic
1104522111 12:129485584-129485606 GCTGCCAGTGTACTCCCTACAGG + Intronic
1104640339 12:130463050-130463072 ACTGCCAGGGGGGTCCCTGCTGG + Intronic
1105818889 13:24062432-24062454 GGCGCCAGGGTGCACGGTGCTGG + Intronic
1106312367 13:28564935-28564957 GCTGCCAACCTCCTCCGTGCCGG - Intergenic
1106805088 13:33298054-33298076 ACTGTCAGGGTGCTCCAGGCAGG - Intronic
1113180568 13:107620587-107620609 GATGCCAGAGTGCTCACTGCTGG - Intronic
1113488842 13:110676549-110676571 CATGCCAGGGTGCTCTGTGGCGG - Intronic
1114181747 14:20373677-20373699 GCTGCCATGGAGCCCCGTGCAGG - Exonic
1118740594 14:68736902-68736924 GCTTCCAGGCTGCTCGGGGCTGG - Intergenic
1119263165 14:73250148-73250170 GCTGCCTGGGGGCTCAGTGCGGG + Intronic
1119428191 14:74549683-74549705 GCTGCCAGGAGCCTCAGTGCTGG + Intronic
1121821904 14:96976662-96976684 GCAGCCAGAGTGCTCCTTCCTGG - Intergenic
1122539965 14:102492650-102492672 GCTGCCTGGGAGCTCCCTGCAGG - Intronic
1122987012 14:105217174-105217196 GCAGCCAGGGTGCGCAGAGCAGG + Intronic
1124425663 15:29560526-29560548 ACTGCCAGGGTGTCCCTTGCAGG + Intronic
1124656885 15:31516107-31516129 TCTGCCAGGAGGCTCCATGCTGG - Intronic
1128423168 15:67514100-67514122 GCTGCCAGCCTGCTCCTTGGGGG + Intergenic
1129742386 15:77995764-77995786 GCTGGCAGGGTCCCCCTTGCAGG + Exonic
1129843097 15:78755713-78755735 GCTGGCAGGGTCCCCCTTGCAGG - Intergenic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1130710287 15:86273780-86273802 GATGCCAGGGTGCTCACTGTGGG + Intronic
1132615956 16:841191-841213 TCAGCCAGGCCGCTCCGTGCAGG + Intergenic
1137697272 16:50469634-50469656 GGTGCCAGGGTGGTGTGTGCTGG - Intergenic
1138351562 16:56348738-56348760 GCTGGCAGGGGTCTCAGTGCCGG + Intronic
1138474945 16:57265076-57265098 GCTGGCAGGGTGCTGTGTGTTGG - Intronic
1138595880 16:58028679-58028701 GCTGCCAAGCTGCTCCGAGAAGG - Intronic
1139402678 16:66695561-66695583 GCTTCCAGGGTGTTCTGGGCAGG - Intronic
1140512194 16:75516776-75516798 GCAGCCCGGCTCCTCCGTGCGGG - Intergenic
1141216877 16:82033313-82033335 ACTGCCAGGATGCTCTGGGCTGG + Intergenic
1143984068 17:10895946-10895968 GCTGCCAGGGTGCTGGGGGTAGG + Intergenic
1145390635 17:22453305-22453327 CCTGCCAGGGTGCCCCGAGGTGG - Intergenic
1148462875 17:47848204-47848226 GCTGCCAGGGGCCTCCTCGCGGG - Exonic
1150651321 17:67012152-67012174 GATTCCAGGGTGCCCTGTGCAGG + Intronic
1150722665 17:67626743-67626765 GCTGCCACAGGGCTCAGTGCAGG - Intronic
1151404917 17:73879972-73879994 TCTGCCAAGGTCCTCTGTGCAGG + Intergenic
1151704966 17:75762675-75762697 ACTGCCAGGGTGCTCTATCCTGG - Intronic
1152246196 17:79185839-79185861 GCAGACAGTGTGCTCGGTGCTGG + Intronic
1152573093 17:81129013-81129035 TGGGCCAGTGTGCTCCGTGCGGG - Intronic
1153526123 18:5996513-5996535 GCTGCTAGAGTGCTGCATGCTGG - Intronic
1155540405 18:26863473-26863495 GCGGCCAGGATGCACCGGGCCGG - Intronic
1160241913 18:77131243-77131265 GCCGCCAGGGAGCTCAGTGCGGG + Intronic
1160299622 18:77668305-77668327 GCTCCCGGGGTGCCCAGTGCTGG - Intergenic
1160673864 19:378309-378331 GCTGCCTGGGTGCTGAGAGCCGG - Intergenic
1160723931 19:609247-609269 GCTGCCGGGGGGCACCGTCCTGG + Intronic
1161118701 19:2513229-2513251 GCCGCCCAGGTCCTCCGTGCAGG - Exonic
1161119588 19:2518082-2518104 GGTGCCAAGGTGCCACGTGCTGG - Intronic
1161330528 19:3684755-3684777 GCTGCCTGGGCCCTACGTGCCGG - Intronic
1162840449 19:13352649-13352671 GCTGCCACTGTTCTCCATGCTGG + Intronic
1163369374 19:16893489-16893511 GCAGCGAGGGGCCTCCGTGCTGG + Intronic
1163390737 19:17028293-17028315 GCTGCCTGGGTGATCAGTGTTGG - Intergenic
1163711889 19:18851961-18851983 GTTCCCAGGGTTCTCCTTGCAGG + Intronic
1164916845 19:32058698-32058720 GCTGACAAGGTGCTCCTTACTGG - Intergenic
926152385 2:10432397-10432419 GCTGCCAGGCTGCCCCAAGCCGG - Intergenic
930508425 2:52313999-52314021 GCTGCCACGTTGCACTGTGCAGG + Intergenic
931997712 2:67854959-67854981 GGTGCCAGGGTACACCTTGCAGG - Intergenic
934132033 2:88957431-88957453 GCTGCCAGTGTGCTGAGTGGTGG - Intergenic
934133541 2:88972076-88972098 GCTGCCAGTGTGCTGAGTGGTGG - Intergenic
934163382 2:89272901-89272923 GCTGCCAGTGTGCTTAGTGATGG - Intergenic
934167472 2:89307316-89307338 GCTGCCAGGGTGCTAAATGGTGG - Intergenic
934203892 2:89909623-89909645 GCTGCCAGTGTGCTTAGTGATGG + Intergenic
934784643 2:96996176-96996198 CCTGCAAGGGTCCTCTGTGCTGG - Intronic
936230301 2:110694688-110694710 GCTGCCAAGGTGCTACCTGGAGG - Intergenic
936451693 2:112638549-112638571 CCTGCCAGGGCCCACCGTGCAGG + Intergenic
937144156 2:119627974-119627996 GTTACCAGGGAGCTCTGTGCAGG - Intronic
944886929 2:204072614-204072636 GATGCGAGGGTGCCCCCTGCTGG - Intergenic
948510210 2:238458916-238458938 TCAGCCAGGATGCTCCGTGTTGG + Intergenic
948572549 2:238926853-238926875 GATGGCAGAGTGCTCCTTGCAGG + Intergenic
948599190 2:239098508-239098530 GCTGGCAGGGTGCTGCATCCGGG - Intronic
948738339 2:240025482-240025504 GCTGCCAGGGTCCTGCGGGTTGG + Intergenic
948889323 2:240899225-240899247 CCTGCCAGGGCGCTGCCTGCAGG + Intergenic
949035641 2:241814664-241814686 GCTGGCCGGGGGCTCCGTGCGGG + Exonic
1173562585 20:44016793-44016815 GCTGCCTGGATGCTCTGGGCTGG + Intronic
1174342810 20:49908377-49908399 GCTGCCAGGCCGCTGCCTGCTGG + Exonic
1175252126 20:57616190-57616212 ATTGCCAGGATGCTCCCTGCAGG + Intronic
1180059713 21:45378630-45378652 ACTGCCAGGCTGCTCCCTCCTGG + Intergenic
1180221839 21:46364203-46364225 GCGGCCAGGGGGCTCCGGGACGG - Intronic
1180854677 22:19038426-19038448 GCTGCCACAGTGCCCCTTGCTGG - Exonic
1181043646 22:20204550-20204572 GCTTCCAGGGTCTTCCATGCAGG + Intergenic
1182281272 22:29218998-29219020 GCTGCCACCGTCCTCCGTGCTGG + Intronic
1182382911 22:29907881-29907903 GCTGCCAGTGTGCTCTTTGTTGG - Intronic
1183301207 22:37060046-37060068 GCTGCCAGGGTGCTCTCAGGAGG - Intronic
1184320815 22:43740941-43740963 GCTGCCAGGTTGCTGCTTCCCGG - Intronic
1184643574 22:45884661-45884683 GCTGCCAGGGGGTTCTGGGCTGG - Intergenic
1185061993 22:48611913-48611935 GCTGCCAGGGGGCTGGGTGTTGG + Intronic
950261164 3:11544206-11544228 GCTGCGATGGGGCTCCGGGCAGG + Intronic
954860854 3:53689266-53689288 GCTGCCAGGGTGCTCCGTGCTGG + Intronic
958574751 3:95934608-95934630 GCTGCCTGGGTGATTCCTGCAGG + Intergenic
961222161 3:125209749-125209771 GCCGCCAGGGCCCTCCGTGATGG - Intronic
961662843 3:128479383-128479405 GCTCCCAGGGTGCTGGGTCCCGG - Intergenic
961666539 3:128496490-128496512 GCGGGCAGGGGGCTCCGCGCGGG + Intergenic
962659715 3:137589164-137589186 GCGGCCAGGGAGCTCTGTCCAGG - Intergenic
968433084 4:570299-570321 GCACCCTGGATGCTCCGTGCAGG + Intergenic
968701115 4:2058805-2058827 GCTTCCCGGGGGCTCCGGGCCGG + Intergenic
969306291 4:6327931-6327953 GCTTCCAGGGGGCTCCCTCCTGG + Intronic
969794760 4:9518772-9518794 GCCTCCATGGTGCTCCATGCAGG + Intergenic
973178538 4:47239882-47239904 GCTGCCACGGGGCTCAGTGCTGG + Intronic
976223009 4:82773195-82773217 CCTGCCTGGGTCCTCAGTGCTGG + Intronic
985104299 4:186485888-186485910 GCTGCCCAGGAGCGCCGTGCTGG - Intronic
985965214 5:3334140-3334162 GCTTCCAGGGTTCCCCGGGCAGG + Intergenic
991090538 5:62689982-62690004 GCTGCCAGGGGGCCCCGGGAGGG + Intergenic
992414909 5:76543155-76543177 GCTGCGAGGGTGTTCTGGGCCGG - Intronic
996756971 5:126945655-126945677 GCTACCAGGGGGCTTTGTGCAGG + Intronic
999531665 5:152469692-152469714 TCTGTCAGGGTGGTCAGTGCCGG + Intergenic
1001861382 5:175058713-175058735 GCTGCCAGGAAGCTCTGAGCAGG - Intergenic
1002564264 5:180101027-180101049 GCTGCCAGTGGGCTCGGGGCTGG + Exonic
1002644200 5:180645260-180645282 GCTGCCTGAGTGCCCCGTGGGGG + Intronic
1003544768 6:7050831-7050853 GTTGCCAGGCTTCTCCGCGCAGG + Intergenic
1003664906 6:8102010-8102032 GGTGCCAGGTAGCACCGTGCTGG - Intronic
1007701836 6:43770317-43770339 CCGGCCAGGGCGCTCGGTGCTGG + Exonic
1015202076 6:130593916-130593938 CCATCCAGGGTGCTCCGTTCTGG + Intergenic
1016471135 6:144375751-144375773 GCTGCCTGGGTGTTGCTTGCTGG + Intronic
1018941259 6:168310054-168310076 CCTGACAGCGTGCTCCGTGTAGG + Intronic
1019603499 7:1897090-1897112 GCTGCACGGGGGCACCGTGCCGG - Intronic
1019622697 7:2000350-2000372 GATGCCTGGCTGCTCTGTGCAGG - Intronic
1023174672 7:37424236-37424258 GCTGCCCAGGTGGTCAGTGCTGG - Intronic
1024395800 7:48865151-48865173 GCTGCCTGGGGGCTGCATGCTGG + Intergenic
1024399436 7:48907125-48907147 GCTGCCTGGGGGCTGCATGCTGG - Intergenic
1029453384 7:100655283-100655305 GCTGCCAGGGTTCTTCTCGCTGG - Intronic
1032550488 7:132779911-132779933 CCTGGCAGGCTGCTCTGTGCTGG + Intergenic
1034349529 7:150407177-150407199 GCTGGCATGGTGCTAGGTGCTGG + Intronic
1036009150 8:4701483-4701505 GCGGCCTGGGTGTTCTGTGCTGG - Intronic
1036391422 8:8327725-8327747 GCTGCCGGGGTCCTCAGAGCAGG + Exonic
1037818937 8:22126364-22126386 AGTGCCAGGGTCCTCCGTGGAGG + Intronic
1038476467 8:27871885-27871907 GCAGGAAGGGTGCTCTGTGCAGG + Exonic
1042560336 8:70069207-70069229 GCTGGCTGGGTGCTCCAGGCTGG + Exonic
1043178821 8:77057805-77057827 GCTGCCAGGAAGCACTGTGCTGG + Intergenic
1044569326 8:93700247-93700269 GCTGCTAGGCTACTCCGAGCAGG - Intronic
1048020376 8:130532930-130532952 GATGCCAGGGAGCTCCCCGCAGG + Intergenic
1048076592 8:131078235-131078257 GCTCCCAGGGCGGTCCTTGCTGG - Intergenic
1049062300 8:140285896-140285918 GCTGGAAGGGTGCTCCCTACGGG - Intronic
1049321724 8:142000363-142000385 GCTGCCAGGGTCCGCCAGGCTGG - Intergenic
1049365537 8:142235133-142235155 GCACCCAGGGCGCTCAGTGCAGG - Intronic
1049583276 8:143422181-143422203 GCTCCCAGGCTGCTCCGGGGAGG + Intronic
1049759841 8:144326965-144326987 ACTCCCAGGGTGCTCTGCGCCGG - Intergenic
1049759850 8:144327007-144327029 GCTCCCAGGGTGCTCTGCGCCGG - Intergenic
1050090940 9:2016238-2016260 GCTGCCAGGGGGCTGCGCCCCGG + Intronic
1056598267 9:88025573-88025595 GCTGCCAGAGTGCCACCTGCTGG - Intergenic
1058932046 9:109730406-109730428 GTTGGCAGGGTCCTCCGTGCTGG + Intronic
1059268762 9:113059938-113059960 GCTGCCGGGGAGCTCCTGGCTGG + Intergenic
1059269898 9:113065387-113065409 GCTGCCGGGGAGCTCCTGGCTGG + Intergenic
1059271032 9:113070835-113070857 GCTGCCGGGGAGCTCCTGGCTGG + Intergenic
1059272165 9:113076281-113076303 GCTGCCGGGGAGCTCCTGGCTGG + Intergenic
1059273300 9:113081723-113081745 GCTGCCGGGGAGCTCCTGGCTGG + Intergenic
1059274436 9:113087169-113087191 GCTGCCGGGGAGCTCCTGGCTGG + Intergenic
1059393047 9:114011461-114011483 GCTGCCAGCGTGCTCCCAGCTGG + Intronic
1060599506 9:124868864-124868886 GCTCCCGGGGTGATCCCTGCCGG - Exonic
1060936047 9:127516867-127516889 GCTGGCAAGGTGCTCCTTGGAGG + Exonic
1061590511 9:131594736-131594758 GCTGAGAGGACGCTCCGTGCCGG - Intronic
1061865258 9:133488832-133488854 TCTGCCAGGGTGGTCTGGGCTGG + Intergenic
1062383791 9:136300179-136300201 GCTGCCCTGGTGCTCCGGGTTGG - Intronic
1062427010 9:136510737-136510759 TCTGGCAGGATGCGCCGTGCCGG + Exonic
1187392152 X:18893260-18893282 GATCCCGGGGTGCTCCTTGCGGG + Exonic
1187527611 X:20068297-20068319 GCTGCCAGGCTTCTCACTGCAGG - Intronic
1192849669 X:74942033-74942055 GCTGCCTGAGTGCTTCCTGCAGG + Intergenic
1195599221 X:106726973-106726995 GCTGGCATGGTGCTTCCTGCTGG + Exonic
1199672855 X:150161392-150161414 GCTGACAGTGTGCTGCCTGCTGG - Intergenic
1200405917 Y:2811360-2811382 GCTGCCAGGCTGCTGCTTGCAGG + Intergenic
1201145374 Y:11062226-11062248 ACCGCCAGGGTGCTGGGTGCAGG + Intergenic