ID: 954861593

View in Genome Browser
Species Human (GRCh38)
Location 3:53695168-53695190
Sequence GGTCCCCGTGGAGGAGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 607
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 569}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954861586_954861593 26 Left 954861586 3:53695119-53695141 CCCAGGGAAAGAAATGGGCAACA 0: 1
1: 0
2: 4
3: 38
4: 380
Right 954861593 3:53695168-53695190 GGTCCCCGTGGAGGAGGTGCTGG 0: 1
1: 0
2: 3
3: 34
4: 569
954861587_954861593 25 Left 954861587 3:53695120-53695142 CCAGGGAAAGAAATGGGCAACAA 0: 1
1: 0
2: 1
3: 29
4: 298
Right 954861593 3:53695168-53695190 GGTCCCCGTGGAGGAGGTGCTGG 0: 1
1: 0
2: 3
3: 34
4: 569

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954861593 Original CRISPR GGTCCCCGTGGAGGAGGTGC TGG Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900318233 1:2069956-2069978 CCGCCCTGTGGAGGAGGTGCCGG + Intronic
900324330 1:2100621-2100643 GGGCCTCGGGGAGCAGGTGCAGG + Intronic
900456587 1:2777870-2777892 GTACCCCTTGGAGGAGGTTCCGG + Intronic
900627862 1:3617598-3617620 GGTCCATGTGCAGGATGTGCAGG - Intergenic
900686840 1:3954183-3954205 GGTCCATGTGCAGGATGTGCAGG + Intergenic
900707488 1:4089716-4089738 TGTTCCCGTGGGGGAAGTGCAGG - Intergenic
900947844 1:5841244-5841266 GGTCTCCCTGGAGGAGAAGCTGG - Intergenic
900957979 1:5899481-5899503 GGTTCCCTTGGGGGAGGTGAAGG + Intronic
901109939 1:6785887-6785909 GGTCCGGGTGGGGGAGGCGCCGG - Intronic
901232109 1:7647090-7647112 GGTCCCTGGAGAGCAGGTGCTGG - Intronic
902043702 1:13510272-13510294 GGTCCTCACGGAGGAGGTACTGG + Intronic
902366672 1:15979736-15979758 GGTACATGTGCAGGAGGTGCAGG + Intergenic
902402838 1:16167501-16167523 GGGCCACGTGGAGGAGAGGCAGG + Intergenic
902409116 1:16202453-16202475 GCTGCCCGTGGAGGAGCTGGAGG + Exonic
902744759 1:18466341-18466363 GGTACACGTGCAGGATGTGCGGG - Intergenic
902782773 1:18715466-18715488 CATCCCCTTGGAGGAAGTGCTGG + Intronic
903266272 1:22159945-22159967 GGTCACCGTGGAGGGGGGCCAGG - Intergenic
903360974 1:22776931-22776953 GGTCCCCTGAGAGGTGGTGCTGG - Intronic
903560032 1:24220277-24220299 GGCCCCTGAGGAGGTGGTGCGGG - Intergenic
904961902 1:34340034-34340056 GGTCTCCGTGGAGAGTGTGCAGG - Intergenic
906518986 1:46456300-46456322 GGGCCCCGGGGAGGAGGGGGAGG + Intergenic
906597941 1:47096517-47096539 GGTACATGTGGAGGATGTGCAGG + Intronic
907306303 1:53514924-53514946 GGCCCCAGTGAGGGAGGTGCTGG + Intronic
907453183 1:54560267-54560289 GGGCTCCCTGGAGGAGGTGATGG + Intronic
909001420 1:70221688-70221710 GGGCCCGGTGGCGGAGGTGGTGG + Exonic
909034609 1:70582722-70582744 GGTACCTGTGCAGGACGTGCAGG + Intergenic
912271950 1:108220338-108220360 GGTACATGTGGAGGATGTGCAGG - Intergenic
914313559 1:146487924-146487946 GGTACACGTGCAGGATGTGCAGG - Intergenic
914344875 1:146790377-146790399 GGTACACGTGCAGGATGTGCAGG + Intergenic
914500789 1:148245457-148245479 GGTACACGTGCAGGATGTGCAGG + Intergenic
914852780 1:151327279-151327301 GACCCCCGCGGAGGGGGTGCGGG + Exonic
916226409 1:162494082-162494104 GGTACACGTGCAGGATGTGCAGG - Intergenic
918193016 1:182194130-182194152 CGTCACCTTGGAGGAGGAGCTGG + Intergenic
919201301 1:194358303-194358325 GGGCGCCGTGGAGCAGGTGGCGG + Intergenic
920260648 1:204685658-204685680 GGCGCGCGTGGAGGGGGTGCCGG - Intronic
920274777 1:204796016-204796038 GATCTCAGTGGAGGAGGAGCAGG - Intergenic
920655006 1:207868517-207868539 GGTCCGTGTGGAGGAGGAGGCGG - Intergenic
922100582 1:222474462-222474484 GGTCACCGTGAGGGAGGAGCTGG + Intergenic
922804274 1:228377561-228377583 GGTCCAGGTGCAGGATGTGCTGG - Exonic
923194938 1:231656649-231656671 GGTACATGTGGAGGATGTGCAGG + Intronic
923772367 1:236948704-236948726 AGTCCCTGTGGAGCAGGTGCTGG - Intergenic
1062888677 10:1038943-1038965 TGTCCCCATGGAGCAGGTGGAGG + Intergenic
1064105379 10:12496754-12496776 GGTCCATGTGCAGGATGTGCAGG + Intronic
1065538031 10:26733645-26733667 GGTTCCAGTGGATGAGGTGGAGG + Intronic
1065838574 10:29681077-29681099 GTTCCCTGTGGAGGTGGGGCAGG + Intronic
1066214953 10:33277307-33277329 GGTCCCCGAGCAGGAGGACCAGG - Intronic
1066280313 10:33910881-33910903 GGTCCATGTGCAGGATGTGCAGG + Intergenic
1066349071 10:34620030-34620052 GGTCTCTGAGGAGGAGGTGGTGG - Intronic
1067107575 10:43376213-43376235 CCTCCCAGGGGAGGAGGTGCTGG - Exonic
1067161095 10:43825779-43825801 GGGGCTCCTGGAGGAGGTGCTGG - Intergenic
1067214883 10:44293440-44293462 GGGGCTCCTGGAGGAGGTGCTGG + Exonic
1067941427 10:50660111-50660133 GATCCCCTTGGATGAGGTGGTGG + Intergenic
1069631801 10:69901777-69901799 GCTCCCCCTGGAGGAGGAGATGG - Intronic
1069654586 10:70078372-70078394 GGGCCACGTGGAGGAGGAGAAGG + Intronic
1069707396 10:70467394-70467416 GGTCCCAGTGGTGGAGGTGGGGG + Intergenic
1069858818 10:71457554-71457576 GGTCCACATGGGGCAGGTGCTGG + Intronic
1070862664 10:79685073-79685095 GATCCCCTTGGATGAGGTGGTGG + Intergenic
1071598183 10:86942926-86942948 GCTCTTCGGGGAGGAGGTGCTGG - Exonic
1071706159 10:88001080-88001102 GATCCACGTGCAGGATGTGCAGG - Intergenic
1072365600 10:94705481-94705503 GGTGCACGTGCAGGATGTGCAGG - Intronic
1072637594 10:97187627-97187649 GGGCCCCATGGAGCAGGAGCTGG - Intronic
1073513467 10:104057121-104057143 GGTGGCAGTGGAGGAGGTGGCGG - Exonic
1073578170 10:104641878-104641900 GGTCAGCGCGAAGGAGGTGCTGG - Exonic
1073910010 10:108331100-108331122 GGTACCTGTGCAGGATGTGCAGG + Intergenic
1074116938 10:110463191-110463213 GGGGCCTGAGGAGGAGGTGCTGG + Intergenic
1074346297 10:112689475-112689497 GGTGCCCTGGTAGGAGGTGCTGG + Intronic
1074703228 10:116110309-116110331 ACTGCCTGTGGAGGAGGTGCTGG + Intronic
1075097472 10:119481968-119481990 GGTCCCCGGGTGTGAGGTGCCGG - Intergenic
1076294708 10:129375475-129375497 GGTGCCCTTGGAGCAGGGGCTGG + Intergenic
1077326670 11:1966994-1967016 GGTCCCCAGTGAGGAGGTGCTGG + Intronic
1077383500 11:2258346-2258368 GGTACCAGTGCAGGATGTGCAGG + Intergenic
1078390324 11:10931280-10931302 GGAGCCCGTGGTGGTGGTGCTGG + Intergenic
1079862078 11:25685900-25685922 TGTCCTCCTGGTGGAGGTGCTGG + Intergenic
1081508002 11:43738239-43738261 GGTCCATGTGCAGGATGTGCAGG + Intronic
1081578240 11:44333150-44333172 GGTCCTTGTGTAGGATGTGCAGG + Intergenic
1081812997 11:45923565-45923587 GGTGTCCGTGGAGGAGGGTCAGG + Intronic
1081938195 11:46918709-46918731 GGGCCCCGCGCAGGAGGCGCCGG - Intergenic
1082810417 11:57476194-57476216 GGTTCCCGTGGAGGAAGAGGTGG - Exonic
1083681086 11:64352183-64352205 GGTGCTGGAGGAGGAGGTGCGGG + Exonic
1083713815 11:64564516-64564538 GGTGCTGGTGGAGGTGGTGCTGG - Intronic
1084014115 11:66368720-66368742 AGGCTCCCTGGAGGAGGTGCCGG + Intronic
1084128764 11:67118437-67118459 GGGCCCCGTGGCGGCGGCGCCGG + Intergenic
1084607336 11:70180116-70180138 GGGCCCTGTGGAGAAGGAGCTGG + Intronic
1084621397 11:70272212-70272234 GGCCCCCCTGGAGGAGGTGGAGG + Exonic
1084891568 11:72239509-72239531 GGTTCTCCTGGAGGAGGTCCCGG + Exonic
1085334628 11:75682186-75682208 GGTACACGTGCAGGATGTGCAGG + Intergenic
1087363646 11:97192648-97192670 GGTACATGTGCAGGAGGTGCAGG + Intergenic
1088372902 11:109110918-109110940 GGTACACGTGCAGGATGTGCAGG + Intergenic
1088554962 11:111052437-111052459 GCTCCTCGGGGAGGAGGTTCTGG - Intergenic
1088588355 11:111379491-111379513 GGTCCCCGCGGGGCCGGTGCAGG - Exonic
1088785908 11:113181642-113181664 GGTACACGTGCAGGACGTGCAGG - Intronic
1089351647 11:117824759-117824781 GGTGGCCGGGGACGAGGTGCGGG + Intronic
1089391040 11:118102025-118102047 GGTACACGTGCAGGATGTGCAGG + Intronic
1089893208 11:121901801-121901823 GGTACACGTGCAGGATGTGCAGG - Intergenic
1090158709 11:124468631-124468653 GGTACACGTGCAGGATGTGCAGG - Intergenic
1090281564 11:125460537-125460559 GGTCCTCCTGCAGGAGATGCAGG - Exonic
1090286596 11:125505066-125505088 GGTCCCCGGGGAGGGGAGGCTGG + Intergenic
1090332505 11:125942947-125942969 GTTCCCCCGGGAGGAGCTGCAGG + Intergenic
1090567637 11:128012718-128012740 GGTACATGTGCAGGAGGTGCAGG - Intergenic
1091253066 11:134160167-134160189 GGTACACGTGCAGGATGTGCAGG - Intronic
1091282906 11:134391968-134391990 GGTCCCCGTGGAGCACCTGCCGG - Exonic
1091335348 11:134762254-134762276 AGTCCCGGTAGAGGAGGCGCCGG + Intergenic
1202809651 11_KI270721v1_random:22174-22196 GGTCCCCAGTGAGGAGGTGCTGG + Intergenic
1092075282 12:5667569-5667591 GGTACATGTGGAGGACGTGCAGG + Intronic
1092744732 12:11662572-11662594 GTTCACCATGGAGGAGGTGTGGG + Intronic
1092789710 12:12060637-12060659 GCTCCTCGGGGAGGAGGTTCTGG - Intronic
1094782841 12:33812818-33812840 GGTACCCGTGTAGGATGTGCAGG + Intergenic
1094830603 12:34298453-34298475 GGGCCCCATGTAGGAGCTGCTGG - Intergenic
1094831365 12:34301771-34301793 GGTCCCCATGTAGGGGGTGCTGG - Intergenic
1094832692 12:34307679-34307701 GGTCCCCACGGAGGGGCTGCTGG - Intergenic
1094833709 12:34312468-34312490 GGTCCCCTCGCAGGGGGTGCTGG + Intergenic
1095901052 12:47328437-47328459 GGTACACGTGCAGGATGTGCAGG + Intergenic
1096403206 12:51324157-51324179 GGCCCCCGAGGAGGAAGTGCGGG + Intronic
1097080219 12:56424841-56424863 GGTGCCAGTGGAGGAGCAGCGGG - Exonic
1098234135 12:68402219-68402241 GGGCCATGTGGAGGAGGTGTGGG - Intergenic
1098322365 12:69258820-69258842 GGTCCCTGTTGTGGAGGTGGTGG - Exonic
1098444974 12:70557179-70557201 GGTACCAAAGGAGGAGGTGCCGG + Intronic
1098733896 12:74072123-74072145 GGTACACGTGTAGGATGTGCAGG - Intergenic
1100115805 12:91302403-91302425 GGTACTTGTGGAGGATGTGCAGG - Intergenic
1100844512 12:98645003-98645025 GGGACCCGAGGAGGAGGGGCAGG + Exonic
1101280940 12:103254884-103254906 GGTACTCGTGCAGGATGTGCAGG - Intronic
1101788700 12:107909548-107909570 GGTGCCTGTGCAGGATGTGCAGG + Intergenic
1103800259 12:123533467-123533489 GGTGGCCATGGAGGAGGAGCGGG - Exonic
1103949704 12:124544082-124544104 GCTCCCCGGGCAGGGGGTGCCGG - Intronic
1104737246 12:131143205-131143227 GCTCGCTGTGGAGGAGGGGCCGG - Intergenic
1104927310 12:132320641-132320663 GGACACGGTGGAGGAGGTGGAGG + Intronic
1104957744 12:132474667-132474689 GGTCACCGCGGAGGAGGGGGCGG - Intergenic
1104957754 12:132474690-132474712 GGTCACCGCGGAGGAGGGGGCGG - Intergenic
1104957782 12:132474759-132474781 GGTCACCGCGGAGGAGGGGGCGG - Intergenic
1104957793 12:132474783-132474805 GGTCACCGCGGAGGAGGGGGCGG - Intergenic
1104957812 12:132474829-132474851 GGTCACCGCGGAGGAGGGGGCGG - Intergenic
1104957823 12:132474853-132474875 GGTCACCGCGGAGGAGGGGGCGG - Intergenic
1104957842 12:132474899-132474921 GGTCACCGCGGAGGAGGGGGCGG - Intergenic
1104957908 12:132475056-132475078 GGTCACCGCGGAGGGGGGGCGGG - Intergenic
1104957929 12:132475102-132475124 GGTCACCGCGGAGGAGGGGGCGG - Intergenic
1104957947 12:132475147-132475169 GGTCACCGCGGAGGGGGGGCGGG - Intergenic
1104957968 12:132475193-132475215 GGTCACCGCGGAGGAGGGGGCGG - Intergenic
1105014176 12:132776139-132776161 GGTACCTGTGTATGAGGTGCTGG - Intronic
1105014191 12:132776218-132776240 GGTACCTGTGTATGAGGTGCTGG - Intronic
1105249114 13:18680605-18680627 GGCCCCCGAGGAGGAGGAGGAGG + Intergenic
1105334790 13:19457390-19457412 GGTACATGTGGAGGATGTGCAGG + Intronic
1105407091 13:20142100-20142122 GACCCCCGAGGAGGAGGAGCAGG - Exonic
1105860131 13:24401999-24402021 GGTACATGTGGAGGATGTGCAGG - Intergenic
1107111176 13:36699681-36699703 GGTACACGTGCAGGATGTGCAGG - Intergenic
1107581706 13:41795911-41795933 GGTACATGTGCAGGAGGTGCAGG - Intronic
1107820993 13:44285589-44285611 GGTCCATGTGCAGGATGTGCAGG + Intergenic
1108374584 13:49802042-49802064 GGTTCACGTGGAGGATGTACAGG - Intergenic
1109141099 13:58714410-58714432 GGGCGCCGTGGAGCAGGGGCTGG - Intergenic
1109771720 13:66983189-66983211 GGTACACGTGCAGGACGTGCAGG - Intronic
1111445186 13:88338642-88338664 GGTACACGTGCAGGATGTGCAGG + Intergenic
1111615911 13:90661423-90661445 GGTGCATGTGGAGGATGTGCAGG - Intergenic
1112319420 13:98393757-98393779 GGGCTCCGTGGAGGAAGTGTGGG - Intronic
1112891021 13:104231680-104231702 GGTACATGTGGAGGATGTGCAGG + Intergenic
1113711332 13:112467274-112467296 GCTCCTGGGGGAGGAGGTGCGGG - Intergenic
1113788774 13:113016459-113016481 GGCCCACGTGGAGGGGTTGCCGG - Intronic
1113835492 13:113326026-113326048 GGTCCTCGGGGAGCTGGTGCGGG - Exonic
1116323548 14:43500279-43500301 GGTACACGTGCAGGATGTGCGGG - Intergenic
1117010325 14:51464353-51464375 GGTACCTGTGCAGGATGTGCAGG - Intergenic
1117135136 14:52728339-52728361 GGTCCCTGTTGAGGATGTGGAGG + Exonic
1118137581 14:63045914-63045936 GGCTCCCGGGGCGGAGGTGCGGG + Intronic
1118774059 14:68962397-68962419 GGCGGCTGTGGAGGAGGTGCTGG - Intronic
1119434185 14:74587134-74587156 GGTCCTGGTGGGGGAGGGGCCGG - Intronic
1119472702 14:74909561-74909583 GGTTCCCGGGGTGGAGGTCCCGG + Exonic
1121105655 14:91277951-91277973 GGTCACCTTGGAGGAGTTCCTGG - Exonic
1121715909 14:96074150-96074172 GGTCCATGTGCAGAAGGTGCAGG - Intronic
1122135033 14:99627910-99627932 GGCCCCCGAGGAGGAAGGGCTGG + Intergenic
1122593387 14:102871411-102871433 CTTCCCGGTGGAGGAGGGGCTGG + Intronic
1122627766 14:103092869-103092891 GGGCTTCCTGGAGGAGGTGCTGG + Intergenic
1122771012 14:104097648-104097670 GGTGCACGTGGAGGCGGGGCAGG + Intronic
1123131894 14:105994062-105994084 GGTCACACTGGAGGAGGTGTTGG + Intergenic
1123586881 15:21768958-21768980 GGTACGTGTGGAGGACGTGCAGG - Intergenic
1124654956 15:31500202-31500224 AATCCCCGGGAAGGAGGTGCAGG + Intronic
1124791424 15:32730891-32730913 CATGCCCGGGGAGGAGGTGCTGG + Exonic
1124952599 15:34337643-34337665 GGTCCCAGTAGAGGAGGAGACGG + Exonic
1124985280 15:34603733-34603755 GGTACACGTGCAGGAAGTGCAGG + Intergenic
1125155398 15:36579642-36579664 AGTCCCCGCCGCGGAGGTGCCGG + Exonic
1125712714 15:41799822-41799844 GGTGACCTTGGAGAAGGTGCTGG + Exonic
1125956196 15:43792665-43792687 GGTCTCCGTGGGGGATGGGCTGG - Intronic
1126197729 15:45950610-45950632 GGTACACGTGCAGGATGTGCAGG + Intergenic
1128061463 15:64738362-64738384 GGTCTGAGTGGAGGAGGAGCCGG - Intergenic
1128061961 15:64740974-64740996 GGTCACCGGGGAGGTGGTTCTGG - Exonic
1128495851 15:68198105-68198127 AGGGCCCGTGGAGGAGGGGCTGG - Intronic
1129413270 15:75361279-75361301 GGGCAGCGTGGAGGAGGTGAGGG - Exonic
1129831923 15:78676268-78676290 GGTCCTTATGGAGGAGGTGGAGG + Intronic
1130026265 15:80273115-80273137 GGTGCCCCTGGAGGAGCTTCAGG + Intergenic
1130048815 15:80466541-80466563 GGTCTGCCTGGAGGAGCTGCAGG - Intronic
1131172926 15:90191196-90191218 GGCCCCAGTGGGGGTGGTGCTGG + Intronic
1132533821 16:467456-467478 GGGCCTCAGGGAGGAGGTGCTGG + Intronic
1132533850 16:467544-467566 GGGCCTCAGGGAGGAGGTGCTGG + Intronic
1132533864 16:467588-467610 GGGCCTCAGGGAGGAGGTGCTGG + Intronic
1132533879 16:467632-467654 GGGCCTCAGGGAGGAGGTGCTGG + Intronic
1132533887 16:467654-467676 GGGCCTCAGGGAGGAGGTGCAGG + Intronic
1132533909 16:467720-467742 GGGCCTCAGGGAGGAGGTGCAGG + Intronic
1132533917 16:467742-467764 GGGCCTCAGGGAGGAGGTGCAGG + Intronic
1132533932 16:467786-467808 GGGCCTCAGGGAGGAGGTGCTGG + Intronic
1132533946 16:467830-467852 GGGCCTCAGGGAGGAGGTGCTGG + Intronic
1132533954 16:467852-467874 GGGCCTCAGGGAGGAGGTGCTGG + Intronic
1132533968 16:467896-467918 GGGCCTCAGGGAGGAGGTGCAGG + Intronic
1132533997 16:467984-468006 GGGCCTCAGGGAGGAGGTGCAGG + Intronic
1132534036 16:468112-468134 GGGCCTCAGGGAGGAGGTGCAGG + Intronic
1132534044 16:468134-468156 GGGCCTCAGGGAGGAGGTGCAGG + Intronic
1132534052 16:468156-468178 GGGCCTCAGGGAGGAGGTGCAGG + Intronic
1132723041 16:1326300-1326322 GGTCCCCGTGGCCCAAGTGCAGG + Exonic
1132751203 16:1458529-1458551 GGTCCCCGTGGCCAAGGAGCGGG - Intronic
1133018540 16:2955824-2955846 GGGGCCCGTGGAGGAGGGGGTGG + Intergenic
1133113164 16:3561745-3561767 GGACCCCGTGATGGAGCTGCTGG - Exonic
1133307464 16:4819650-4819672 GGTCAAAGTGGAGGAGCTGCCGG - Intronic
1133449165 16:5889117-5889139 GGTCCATGTGTAGGATGTGCAGG + Intergenic
1133512365 16:6472309-6472331 GGTACACGTGGTGGAGATGCTGG + Intronic
1133684318 16:8151331-8151353 GGTACACGTGCAGGATGTGCAGG + Intergenic
1134300891 16:12989802-12989824 GGTCCATGTGTAGGATGTGCAGG + Intronic
1135346145 16:21690211-21690233 GGTACACGTGCAGGATGTGCAGG + Intronic
1135562873 16:23489898-23489920 AGTACCCTTGGAGGAGGAGCAGG + Intronic
1135951909 16:26922206-26922228 GGTACACGTGAAGGATGTGCAGG - Intergenic
1136063484 16:27742876-27742898 GGTACACGTGCAGGATGTGCAGG + Intronic
1136106652 16:28034846-28034868 TGTCCCTGGGGTGGAGGTGCAGG + Intronic
1136412695 16:30086290-30086312 GGCCCCCTTGGAGAAAGTGCGGG + Exonic
1136539542 16:30921801-30921823 GGACCCCGATGAGGAGGGGCGGG + Intergenic
1138460047 16:57142691-57142713 TGTCCCAGTGGAGGGGGAGCTGG + Intronic
1138912686 16:61421134-61421156 GGTACACGTGCAGGACGTGCAGG + Intergenic
1139265466 16:65634464-65634486 GGTCCCCCTGGAGGATGAGTGGG - Intergenic
1139280127 16:65763563-65763585 GGGCCCCTTGGAAGAGGGGCAGG + Intergenic
1139482217 16:67236838-67236860 AGGCCCAGTGGAGGAGGTGGGGG + Intronic
1139989117 16:70924927-70924949 GGTACACGTGCAGGATGTGCAGG - Intronic
1140414116 16:74761078-74761100 GGTACACGTGCAGGATGTGCAGG - Intronic
1140649012 16:77066369-77066391 GGTACCTGTGCAGGACGTGCAGG + Intergenic
1141586442 16:85036756-85036778 TGTCCCCGGGCAGGGGGTGCTGG - Intronic
1141624657 16:85254882-85254904 GGTCCCAGTGCTGGAGGTGGAGG + Intergenic
1141865203 16:86745488-86745510 GGTCCTTGGGGAGGAGGTTCTGG + Intergenic
1141961538 16:87412435-87412457 CGTCCCCGTGGCGGCCGTGCTGG + Exonic
1142292486 16:89199449-89199471 TGCCCCCGTGGAGTAGGCGCAGG + Exonic
1142299156 16:89246804-89246826 GGTACACGTGCAGGATGTGCAGG - Intergenic
1142398254 16:89845234-89845256 TGTCCCCGAGGGGGAGGTGGGGG + Intronic
1142412515 16:89923732-89923754 AGGCCCGGTGGAGGGGGTGCAGG - Intronic
1142418173 16:89954339-89954361 GGGCCCTGGGGAGGAGGTCCCGG + Exonic
1142631622 17:1229567-1229589 GTTCCCCGGGGCGGAGGCGCCGG - Intergenic
1142648531 17:1330810-1330832 GGTACCTGTGCAGGAGGTGCAGG + Intergenic
1143015095 17:3887463-3887485 GGCCTCCCTGGAGGAGGTGAAGG + Intronic
1144432479 17:15206895-15206917 GGTACATGTGGAGGATGTGCAGG - Intergenic
1144779153 17:17799248-17799270 GGTGCCCATGGAGGAGGGGTCGG + Intronic
1144876812 17:18401342-18401364 GGCAACCTTGGAGGAGGTGCAGG - Intergenic
1145155418 17:20543076-20543098 GGCAACCTTGGAGGAGGTGCAGG + Intergenic
1145208243 17:20995847-20995869 GGTCCCCCATGAGGAGCTGCAGG + Intergenic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1147310070 17:39590507-39590529 GGTACCTGTGCAGGATGTGCAGG - Intergenic
1147677590 17:42218772-42218794 CGGCCCAGTGGAGGAGATGCTGG - Exonic
1147688449 17:42300799-42300821 CGGCCCAGTGGAGGAGATGCTGG + Exonic
1148204999 17:45774626-45774648 GATCCCCGTGGAGGAAATGCAGG - Intergenic
1150445286 17:65223701-65223723 GGTCCTCGAGAAGGAGGTGAGGG - Intronic
1150747372 17:67826144-67826166 GGTCTCCGAGGAGGAGGAGGAGG + Exonic
1150819095 17:68420611-68420633 GGTCGGCGTGGAGGAGGGACAGG - Exonic
1151888900 17:76940567-76940589 GGTCCCCGATCAGGAGGGGCCGG + Intronic
1152093477 17:78259163-78259185 GGTCCCAGTTGGGGAAGTGCAGG - Intergenic
1152182067 17:78828673-78828695 GCTCGCCCTGTAGGAGGTGCTGG - Intronic
1152622633 17:81372894-81372916 GGTCCAAGTGGAGGGGATGCAGG - Intergenic
1152656759 17:81523494-81523516 GGGCCCCTGGGAGTAGGTGCTGG + Intronic
1152701450 17:81821856-81821878 CCTCCCCGGGGAGGAGGAGCAGG - Intergenic
1152942235 17:83178767-83178789 GGAGCCCGTGCAGGAGGTCCTGG + Intergenic
1153171932 18:2326738-2326760 GATCCCCCTGGATGAGGAGCTGG - Intergenic
1153686528 18:7551795-7551817 GGTACCTGTGCAGGATGTGCAGG + Intergenic
1153929534 18:9866427-9866449 GGTCCCCTTCCAGGAGGTGGTGG + Intergenic
1154303126 18:13212212-13212234 GGTCCATGTGCAGGACGTGCAGG + Intergenic
1154439771 18:14378625-14378647 GGCCCCCGAGGAGGAGGAGGAGG - Intergenic
1154511318 18:15105554-15105576 GGTACACGTGCAGGATGTGCAGG - Intergenic
1156337370 18:36183632-36183654 GGTCCTGGAGGAGGAGGTGGGGG - Intergenic
1156462973 18:37332009-37332031 GCTGCACGTGCAGGAGGTGCAGG + Intronic
1157478237 18:48036830-48036852 GGTCCCCGTGGAAAGGCTGCAGG + Intronic
1157565398 18:48676020-48676042 GGTCCTGGGGGAGGGGGTGCCGG - Intronic
1158894635 18:61901366-61901388 GGTCCACTTGGATGAGGTGCAGG - Intergenic
1160176568 18:76600163-76600185 GGGCCCCGTGGAGCAGGGGGTGG + Intergenic
1160521489 18:79510793-79510815 GAGCCCCGTGGAGGGGATGCCGG - Intronic
1160562864 18:79770549-79770571 GGTCCAGAGGGAGGAGGTGCGGG + Intergenic
1160772856 19:840858-840880 GGACTCCGGGGAGGAGGTGGGGG - Intergenic
1160881664 19:1323555-1323577 GGTCTCGGTGCAGGAGGTGGAGG + Intergenic
1162320117 19:9966653-9966675 GGGCGGCCTGGAGGAGGTGCTGG - Exonic
1162841508 19:13359729-13359751 GGTCCCATTGGGGCAGGTGCGGG + Exonic
1163298721 19:16429758-16429780 GGTCCCCGTGGAGTCTGTGGAGG - Intronic
1163473634 19:17512240-17512262 GGCCCCCGTAGTCGAGGTGCAGG - Intronic
1163487290 19:17595675-17595697 GCTCCTGGTGGAGGAGGTTCTGG - Intergenic
1163580769 19:18137371-18137393 GATCCCCCTGGAGGGGGGGCGGG + Intronic
1163610926 19:18301199-18301221 GGTTCCAGTGGAGGCGGGGCAGG + Intergenic
1164999686 19:32750972-32750994 GGTACCTGTGCAGGATGTGCAGG + Intronic
1165064590 19:33221585-33221607 GGGCCCCGGTGAGGAGGGGCTGG + Intronic
1165149591 19:33753178-33753200 GCTCCCCCTGGTGAAGGTGCAGG - Intronic
1165157098 19:33795634-33795656 GGTCGCCGAGGAGGAGGAGGAGG + Intergenic
1165253618 19:34559349-34559371 GGTCCCGGGGGAGGGGGTGCCGG + Intergenic
1165454748 19:35903980-35904002 GGAAGCCCTGGAGGAGGTGCTGG + Intronic
1165532723 19:36417835-36417857 GGTCCGCGAGGAGGTGGTGTGGG + Intronic
1166069265 19:40377797-40377819 GGTCCCCGCGGATGAGGCCCAGG + Exonic
1166373648 19:42315538-42315560 GGTCCTGGGGGAGGAGGGGCTGG + Intronic
1166378945 19:42344513-42344535 GGTCCCCGTGGAGGGGCTGTGGG - Exonic
1166862049 19:45816475-45816497 GGGGCCCTTGGAGGAGGTGAGGG - Exonic
1167244457 19:48365138-48365160 GGTCACAGAGGTGGAGGTGCAGG - Intronic
1167409244 19:49335307-49335329 TGTCCCAGTGGAGCAGGTGAGGG + Intronic
1167471322 19:49677724-49677746 GGTCCCCGGGGAGGAGGGCTGGG - Intronic
1167593168 19:50415180-50415202 GTTCCCAGAGGAGGAGGGGCTGG - Intronic
1167596912 19:50432719-50432741 GGTCCCCAGGGAGGAGGGGCTGG - Intergenic
1168059570 19:53883368-53883390 GGCCACCGCGGAGGTGGTGCTGG + Intronic
1168332984 19:55580491-55580513 GGTCCCGGTGGAGGAGGGGCTGG + Intronic
1168340740 19:55621789-55621811 GGACCCTGCGGAGGAGGGGCGGG - Exonic
925165073 2:1710878-1710900 GGTGCTGGTGGAGCAGGTGCTGG - Intronic
925173436 2:1766765-1766787 GCTCCCAGAGGAGCAGGTGCAGG + Intergenic
926742736 2:16125936-16125958 GGTCCCTGTGGTGGAGGCACAGG - Intergenic
927486833 2:23494397-23494419 CATCTCCGTGGAGGAGCTGCTGG - Intronic
927632589 2:24787313-24787335 GGTACCTGTGCAGGATGTGCAGG + Intergenic
928167227 2:28980179-28980201 GGTCCCTCTGGGGCAGGTGCTGG - Intronic
928801484 2:35099340-35099362 GGTACACGTGCAGGATGTGCAGG + Intergenic
929512984 2:42580312-42580334 GGTACCTGTGCAGGATGTGCAGG + Intronic
931657589 2:64524363-64524385 GGTCTCCGCGGAGGAGGTGGAGG + Exonic
932180526 2:69642884-69642906 GGTCACAGTGGACGAGGTGTTGG - Exonic
932284749 2:70522736-70522758 GGTACACGTGCAGGATGTGCAGG + Intronic
933228223 2:79775490-79775512 GGTACATGTGCAGGAGGTGCAGG + Intronic
934141262 2:89050166-89050188 GATCCCGGGGGAGGAGGTCCTGG - Intergenic
934227978 2:90150378-90150400 GATCCCAGGGGAGGAGGTCCTGG + Intergenic
934980107 2:98832460-98832482 AGCCCCCCTGGAGGAGGTGGTGG + Exonic
935797739 2:106661827-106661849 GGTACATGTGCAGGAGGTGCAGG - Intergenic
936388788 2:112054575-112054597 GGGCCGCGTGGAGGCGGGGCCGG - Intergenic
937427965 2:121815507-121815529 GGGCTCCGTGGAGAAGGTGAAGG + Intergenic
938086413 2:128405036-128405058 GGCCCCCGTGGTGGCTGTGCTGG + Intergenic
938675560 2:133630106-133630128 GGTCCATGTGCAGGATGTGCAGG - Intergenic
939304768 2:140397206-140397228 GGTACACGTGCAGGATGTGCAGG + Intronic
939382771 2:141457559-141457581 GGTACACGTGTAGGATGTGCAGG - Intronic
943331877 2:186569610-186569632 GGTACCTGTGCAGGACGTGCAGG - Intergenic
944061887 2:195578520-195578542 GGTACCTGTGCAGGATGTGCAGG - Intronic
944199911 2:197095519-197095541 GGTCCTGGTGGCTGAGGTGCAGG - Intronic
944849804 2:203706648-203706670 GTTCCTCGGGGAGGAGGGGCTGG + Exonic
945212756 2:207400631-207400653 GGTACACGTGCAGGATGTGCTGG - Intergenic
945612559 2:212022653-212022675 GGTACACGTGCAGGATGTGCAGG - Intronic
946125559 2:217559526-217559548 GGTCCATGTGCAGGATGTGCAGG - Intronic
946395554 2:219442165-219442187 GGGCCCGGTGGAGGGGGCGCTGG + Intronic
947082084 2:226410133-226410155 GGTACACGTGCAGAAGGTGCAGG + Intergenic
947734442 2:232447365-232447387 GGTCCCCGAGGAAGAGGAGGAGG + Intergenic
948573036 2:238929260-238929282 GGAAGCCCTGGAGGAGGTGCTGG + Intergenic
948606226 2:239137412-239137434 CCTCCCTGTAGAGGAGGTGCCGG + Intronic
948687385 2:239677646-239677668 GGCCCCCCTGGAGGAGGTGTGGG - Intergenic
948694493 2:239726347-239726369 GTTCCCTGGGGAAGAGGTGCTGG - Intergenic
948749322 2:240121788-240121810 GGGCCCCGTGCAGGAAGCGCAGG - Intergenic
948787766 2:240361880-240361902 AGGCCCAGTGGAGCAGGTGCCGG + Intergenic
1169340884 20:4795433-4795455 GGTCCCAGTGGGGAGGGTGCTGG + Intronic
1169713535 20:8590842-8590864 GGTCCATGTGCAGGACGTGCAGG + Intronic
1171137831 20:22712824-22712846 GGTACATGTGGAGGATGTGCAGG + Intergenic
1172591403 20:36120670-36120692 GGACCCAGTGGAGGAGCAGCTGG - Intronic
1173337338 20:42123516-42123538 GGTCCCCTCAGAGGAGGTGGTGG + Intronic
1173499903 20:43545561-43545583 CTTCCCCATCGAGGAGGTGCTGG + Intronic
1173982940 20:47239005-47239027 GGTGACCGTGGAGGACGTGCTGG + Exonic
1174080945 20:47970438-47970460 GGTCAAAGTGGAGGAGGTGAGGG - Intergenic
1175501298 20:59452957-59452979 GGTGCAGCTGGAGGAGGTGCAGG + Intergenic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1176143686 20:63556026-63556048 GGTCCCCGAGCAGCAGGAGCTGG - Exonic
1176381573 21:6116550-6116572 GGTCCCGGTGGACGATGTGATGG - Exonic
1176455973 21:6911148-6911170 GGCCCCCGAGGAGGAGGAGGAGG + Intergenic
1176834147 21:13776196-13776218 GGCCCCCGAGGAGGAGGAGGAGG + Intergenic
1177118448 21:17112900-17112922 GGTACCTGTGTAGGATGTGCAGG - Intergenic
1177725636 21:24963392-24963414 GGTGCACGTGCAGGATGTGCAGG + Intergenic
1179015282 21:37590474-37590496 GCTCCCGGGGGAGGAGGTTCTGG + Intergenic
1179336407 21:40460247-40460269 GGTACCTGTGCAGGATGTGCAGG - Intronic
1179434929 21:41354808-41354830 GGTACACGTGCAGGATGTGCAGG - Intronic
1179741899 21:43421689-43421711 GGTCCCGGTGGACGATGTGATGG + Exonic
1179862431 21:44197337-44197359 GGGCCTGGTGGAGGAGGTCCTGG + Intergenic
1179881340 21:44294443-44294465 AGCCCCTGTGGAGGGGGTGCTGG + Exonic
1180647042 22:17347835-17347857 GGTCCCAGTGGACGTGGTGCGGG - Intergenic
1180707240 22:17817357-17817379 GGCCCCGCTGGAGGGGGTGCTGG + Exonic
1180831070 22:18906389-18906411 GGGCGCCTTGGAGGAGGTGGCGG + Exonic
1180868208 22:19131786-19131808 GGTCCCGGTGGACGATGTCCAGG - Exonic
1180953565 22:19731432-19731454 GGGCCCCGTGGAGGAGGTCCTGG + Intergenic
1181068772 22:20319952-20319974 GGCCGCCTTGGAGGAGGTGGCGG - Exonic
1181480159 22:23193785-23193807 GGTCCCTGTGGAGGAGTGACAGG + Intronic
1182041811 22:27243911-27243933 GGTACCTGTGTAGGATGTGCAGG - Intergenic
1182195594 22:28512885-28512907 GGTACACGTGCAGGATGTGCAGG - Intronic
1182421001 22:30248536-30248558 GGTCCTTGTGCAGGAGATGCTGG - Intergenic
1182710722 22:32321482-32321504 GGTACACGTGCAGGACGTGCAGG + Intergenic
1183306639 22:37086376-37086398 GGAGCCCGTGGTGGAGGTTCTGG - Exonic
1183702309 22:39457472-39457494 GGTCCCCGGCGGGGAGATGCTGG - Exonic
1184048642 22:41988342-41988364 GGGCCCCATGAAGGAAGTGCTGG + Intronic
1184342107 22:43891754-43891776 GGGCGCCCTGGAGGAGGCGCGGG + Exonic
1184625280 22:45722693-45722715 GGTCCAAGCGGATGAGGTGCAGG - Intronic
1184650901 22:45919086-45919108 GGCCCCCTGGGAGGATGTGCAGG + Intergenic
1184804923 22:46788557-46788579 GGTCCCAGTGGGGCTGGTGCTGG - Intronic
1184805623 22:46793260-46793282 GGTCACCTGGGAGGAGGCGCAGG - Intronic
1185284354 22:49993771-49993793 GGCCACCGTGGAGGTGGGGCTGG - Intergenic
1185298762 22:50068196-50068218 GGTCCCTGTGAAGCAGGTGGTGG + Intronic
1185413437 22:50697583-50697605 GGGCCCCGGGGCGGCGGTGCGGG - Intergenic
1203281157 22_KI270734v1_random:131660-131682 GGGCGCCTTGGAGGAGGTGGCGG + Intergenic
949418408 3:3837751-3837773 GGTACCTGTGCAGGATGTGCAGG + Intronic
950142058 3:10622236-10622258 AGTCCCCGTGGAGAAGATGGGGG - Intronic
950680223 3:14580109-14580131 GGTCCCTGTGGGGCAGGGGCTGG + Intergenic
951823144 3:26836544-26836566 GGTGCTGGTGGTGGAGGTGCTGG + Intergenic
953055871 3:39386834-39386856 GGGCACCTTGGAGGAGGAGCTGG + Intronic
953138471 3:40204917-40204939 GGTGCCCGTGGAAGGGGTGCTGG - Intronic
953173087 3:40525118-40525140 GGTCCGGGTGAAGGAGGGGCGGG - Exonic
953684343 3:45064614-45064636 GGTGTCCGTGGGGGAGGTGGGGG + Intergenic
953825701 3:46249754-46249776 GCTCCTCGGGGAGGAGGTTCTGG + Intronic
953992668 3:47496236-47496258 GTTCCCAGTGGAGCAGGTCCTGG - Intronic
954106112 3:48410618-48410640 TGTCCCTGTGGAGGAGGAGATGG - Intronic
954136374 3:48583931-48583953 GGTCCCCCTGGACCAGGTGAAGG - Exonic
954617153 3:51975002-51975024 CGTCTGCGTGGAGGGGGTGCTGG - Intronic
954861593 3:53695168-53695190 GGTCCCCGTGGAGGAGGTGCTGG + Intronic
958523382 3:95221211-95221233 GGTACACGTGCAGGATGTGCAGG + Intergenic
960155212 3:114291799-114291821 GTTCCCCGTGGAGTCTGTGCAGG + Intronic
962258513 3:133887964-133887986 GGTCTCCGTGTGGGAGCTGCTGG - Intronic
964127297 3:153248718-153248740 GGTACCTGTGCAGGATGTGCAGG + Intergenic
965683500 3:171276378-171276400 GGAACCTGTGGAGGAGGGGCTGG + Intronic
967859017 3:194137886-194137908 GGTCCCGGTGGGGGCGGTGGCGG - Exonic
968320397 3:197762978-197763000 GGTACACGTGCAGGATGTGCAGG - Intronic
968436540 4:593468-593490 GGTACCTGTGCAGGATGTGCAGG + Intergenic
968471705 4:785644-785666 GCTGCCCACGGAGGAGGTGCTGG + Exonic
968902195 4:3437005-3437027 GGCCCCTCTGGAGGTGGTGCAGG + Intronic
969294676 4:6262940-6262962 CGGCTCCCTGGAGGAGGTGCTGG - Intergenic
969299815 4:6291318-6291340 GGTGGCCGTGGCGGAGCTGCTGG + Exonic
969444850 4:7238970-7238992 GCTCCCAGTGGTGGAGCTGCTGG - Intronic
969557172 4:7919659-7919681 GGTACACGTGCAGGATGTGCAGG + Intronic
969639541 4:8388700-8388722 GGGCCGAGTGAAGGAGGTGCGGG + Intronic
970284272 4:14492675-14492697 GGTACTTGTGCAGGAGGTGCAGG + Intergenic
970650280 4:18170175-18170197 GGGACACATGGAGGAGGTGCAGG + Intergenic
973613512 4:52658777-52658799 CGTCCCCGGGGAGGGGGTGGGGG - Intronic
974584662 4:63856403-63856425 GGTACCTGTGCAGGATGTGCAGG - Intergenic
975683654 4:76898646-76898668 GGACCCCTTGGAGGGGGCGCCGG - Intergenic
976040879 4:80883892-80883914 GGTACACGTGCAGGATGTGCAGG + Intronic
976884574 4:89968260-89968282 GCTCCTCGGGGAGGAGGTTCTGG + Intergenic
980858493 4:138469976-138469998 GGTACACGTGCAGGATGTGCAGG + Intergenic
981148029 4:141348940-141348962 GCTTCCCGTGGAAGAGGGGCAGG + Intergenic
981628907 4:146794820-146794842 GGTACACGTGCAGGATGTGCAGG + Intronic
981866080 4:149420600-149420622 GGTCCATGTGCAGGATGTGCAGG - Intergenic
982195110 4:152904078-152904100 GGTACACGTGCAGGATGTGCAGG + Intronic
983167905 4:164499302-164499324 GGTACACGTGCAGGATGTGCAGG - Intergenic
985345099 4:188996381-188996403 GGTACGCGTGCAGGATGTGCAGG + Intergenic
985607076 5:863527-863549 GGGCACCCTGCAGGAGGTGCTGG + Intronic
985693454 5:1326303-1326325 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693476 5:1326482-1326504 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693500 5:1326654-1326676 TGTCCCCGTAGAGGAGGAGCTGG - Intronic
985693507 5:1326683-1326705 TGTCCCCGTAGAGGAGGAGCTGG - Intronic
985693514 5:1326712-1326734 TGTCCCCGTAGAGGAGGAGCTGG - Intronic
985693519 5:1326741-1326763 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693525 5:1326770-1326792 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693556 5:1326973-1326995 TGTCCCTGTGGAGGAGGAGCTGG - Intronic
985693562 5:1327002-1327024 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693569 5:1327031-1327053 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693576 5:1327060-1327082 TGTCCCTGTCGAGGAGGAGCTGG - Intronic
985693606 5:1327263-1327285 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693632 5:1327437-1327459 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693638 5:1327466-1327488 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693643 5:1327495-1327517 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693649 5:1327524-1327546 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693674 5:1327698-1327720 TGTCCCTGTAGAGGAGGAGCAGG - Intronic
985693679 5:1327727-1327749 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693686 5:1327756-1327778 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693704 5:1327872-1327894 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693774 5:1328367-1328389 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693818 5:1328744-1328766 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693839 5:1328918-1328940 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985836244 5:2274179-2274201 GGTTCGCGTGCAGGATGTGCAGG + Intergenic
985908894 5:2863871-2863893 GGTTCCCTTCGAGGAGGGGCCGG + Intergenic
986123970 5:4868231-4868253 AGTCACAGGGGAGGAGGTGCAGG + Intergenic
987218685 5:15767027-15767049 GGTACCCGTGCAGGATGTGTAGG + Intronic
987299214 5:16581866-16581888 GGTACCTGTGCAGGATGTGCAGG + Intronic
988031032 5:25762523-25762545 GGTACACGTGTAGGATGTGCAGG + Intergenic
988163908 5:27558365-27558387 GGTACACGTGTAGGATGTGCTGG - Intergenic
989029095 5:37099153-37099175 GGTACACGTGCAGGATGTGCAGG + Intergenic
992050412 5:72935572-72935594 GGGCACCGTGGAGCAGGGGCAGG - Intergenic
992636616 5:78730940-78730962 GGTCCCTGAGGGGGAGGTGAGGG + Intronic
993308591 5:86299667-86299689 GGTACATGTGGAGGATGTGCAGG + Intergenic
994556935 5:101317179-101317201 GCTCCTCGGGGAGGAGGTTCTGG - Intergenic
994707393 5:103223217-103223239 GGCCTGCGTGGAGGAGGTGGAGG + Intergenic
995353132 5:111205346-111205368 GGTCCCTCTGGAGGAGCTGCTGG - Intergenic
995566138 5:113434431-113434453 GGTCCCGGTGGACGACGTCCAGG + Exonic
995784741 5:115816295-115816317 GGTCAATGTAGAGGAGGTGCAGG - Exonic
997356707 5:133267184-133267206 GGTCTGGGAGGAGGAGGTGCAGG + Intronic
997428572 5:133821663-133821685 GGGCACTGTGGAGGAGGCGCAGG + Intergenic
997454324 5:134005879-134005901 GGGCCCTGTGGAGGAGGTGCCGG + Intergenic
997588747 5:135060248-135060270 GGCCCCTGTGGAAGAGGTGGGGG + Intronic
998366943 5:141637836-141637858 GGCCGGCGTGGAGGAGGTGCGGG + Exonic
1000818365 5:165952831-165952853 GGTACACGTGCAGGATGTGCAGG - Intergenic
1001754015 5:174152489-174152511 GGTACGAGTGGAGGAGGTGAGGG - Intronic
1003202126 6:3970949-3970971 GGTACATGTGGAGGATGTGCAGG - Intergenic
1003881025 6:10479837-10479859 GGTACACGTGTAGGAGGTGCAGG + Intergenic
1004283526 6:14300419-14300441 GCTCCTCGGGGAGGAGGTTCTGG + Intergenic
1005561480 6:27045561-27045583 GGTGCCCGTGGAGTAGGGGGCGG - Intergenic
1005671667 6:28112595-28112617 GGTTCTGGGGGAGGAGGTGCAGG - Intergenic
1005694168 6:28335933-28335955 AGCCCCCGTGGAGTAGGTGGAGG - Intronic
1005858553 6:29883615-29883637 GGTACACGTGCAGGATGTGCAGG - Intergenic
1006003828 6:30987269-30987291 GGTCCCACTGGAGGTCGTGCTGG - Exonic
1006304525 6:33211306-33211328 CGACCCCGTGGAGGGGGCGCAGG + Exonic
1007780104 6:44247743-44247765 AGTCCCGGTGGAGGAGGGGCGGG + Intronic
1008369394 6:50715382-50715404 GCTCCCCGTGGTGGATCTGCTGG - Exonic
1010174569 6:73012787-73012809 GGTACACGTGCAGGATGTGCAGG - Intronic
1012624972 6:101393776-101393798 GGTCCTCGGGGAGGAGCAGCCGG - Intergenic
1012979315 6:105812992-105813014 GGTCCATGTGCAGGATGTGCAGG - Intergenic
1014413950 6:121161217-121161239 GGTACCTGTGCAGGATGTGCAGG + Intronic
1014612081 6:123558884-123558906 GGTCCTGGGGGAGGAGGTTCTGG - Intronic
1014788516 6:125644760-125644782 GGCCCTCGTGGAGGAGGCTCGGG - Intergenic
1015604397 6:134940193-134940215 GGTACACGTGCAGGACGTGCAGG - Intronic
1016197712 6:141366316-141366338 GGTACACGTGCAGGATGTGCAGG + Intergenic
1016867835 6:148786253-148786275 GGTCCGTGTGCAGGATGTGCAGG + Intronic
1017745152 6:157440131-157440153 GGTACCTGTGCAGGATGTGCAGG - Intronic
1017810874 6:157982299-157982321 GATCCCCGTGGAGGGGCGGCCGG - Intronic
1018495404 6:164342201-164342223 GCTCCTGGTGGAGGAGGTTCTGG + Intergenic
1018588857 6:165394100-165394122 GGTCCACGTGCAGAACGTGCAGG + Intronic
1018613381 6:165663195-165663217 GCTGCCCGTGGAGGCGGTGGTGG + Intronic
1018887413 6:167951644-167951666 GGCCCGCCTGGAGGAGGAGCGGG + Exonic
1018908796 6:168090123-168090145 GGTCCCAGTGGTGGACGTGGAGG - Intergenic
1019170540 6:170131032-170131054 GGTCACCGTGGAGGAGCTCGGGG - Intergenic
1019515547 7:1438347-1438369 GGTCTCCCTGGAGAAGGAGCAGG + Exonic
1021381911 7:19977893-19977915 GGTACACGTGGAGAATGTGCAGG - Intergenic
1021462584 7:20905308-20905330 GGTCCATGTGCAGGACGTGCAGG - Intergenic
1022228393 7:28387769-28387791 GGTCCATGTGCAGGATGTGCAGG - Intronic
1022272296 7:28820574-28820596 GAACCCCATGGATGAGGTGCAGG + Exonic
1023053658 7:36274574-36274596 GGTACACGTGCAGGATGTGCAGG + Intronic
1023435139 7:40134503-40134525 GGTCCGGGTGGAGGAGGTTGGGG - Exonic
1024213439 7:47227083-47227105 GGTGTGCCTGGAGGAGGTGCTGG - Intergenic
1024255382 7:47536913-47536935 GGTGCCCGTGGACGCTGTGCTGG - Intronic
1024405800 7:48978546-48978568 GGTACACGTGCAGGAAGTGCAGG + Intergenic
1025021670 7:55485254-55485276 GTTCCCTGTGGAGGAGAAGCTGG - Intronic
1025129335 7:56367518-56367540 GGCCCCCGTGAGGGAGGAGCAGG - Intergenic
1026259379 7:68741151-68741173 GGTACACGTGCAGGATGTGCAGG - Intergenic
1026491852 7:70870342-70870364 GGTTCACGTGCAGGATGTGCAGG + Intergenic
1026638445 7:72104421-72104443 GGTCCATGTGCAGGATGTGCAGG + Intronic
1026807233 7:73436002-73436024 GGTCCTAGTGGAGGATGTGGAGG + Exonic
1026823568 7:73566510-73566532 GGTCCATGTGCAGGATGTGCAGG + Intergenic
1027019344 7:74800769-74800791 GGTCCATGTGCAGGATGTGCAGG - Intronic
1027068682 7:75145172-75145194 GGTCCATGTGCAGGATGTGCAGG + Intronic
1027425399 7:78056787-78056809 GGTCCATGTGCAGGATGTGCAGG - Intronic
1027674524 7:81142067-81142089 GGGCCCCGTGGAGCAGGGGGCGG - Intergenic
1027987898 7:85318425-85318447 GGTACCTGTGGAGGATGTGCAGG + Intergenic
1029545579 7:101208801-101208823 CTTCCCAGAGGAGGAGGTGCAGG - Intronic
1029611177 7:101627412-101627434 GCTCCCCAGGGAGGAGGTGGAGG + Intronic
1029744012 7:102506771-102506793 CGACCCCGACGAGGAGGTGCAGG - Exonic
1029762001 7:102605934-102605956 CGACCCCGATGAGGAGGTGCAGG - Exonic
1029988217 7:104940482-104940504 GGGCACCGTGGAGCAGGTGGCGG - Intergenic
1035567056 8:648388-648410 GGTCGCAGTAGGGGAGGTGCTGG + Intronic
1035910878 8:3565047-3565069 GGTCCATGTGCAGGATGTGCAGG - Intronic
1036708021 8:11059587-11059609 GGTGCCAGTGGAGGAGGAGCAGG + Intronic
1038518827 8:28211419-28211441 GGTCCCTGTGCAGGATATGCAGG - Intergenic
1038554097 8:28494476-28494498 GATCCCTGAGGAGGAGGCGCCGG - Intronic
1041193391 8:55375750-55375772 GGTACACGTGCAGGATGTGCAGG + Intronic
1042200389 8:66275285-66275307 TGACCCCATGGAGGAGGTTCTGG - Intergenic
1042490106 8:69387509-69387531 GGTCCATGTGCAGGATGTGCAGG - Intergenic
1042829270 8:73009042-73009064 GGCCCCCGAGGAGGAGGAGGAGG + Exonic
1044554630 8:93549636-93549658 GGTACATGTGCAGGAGGTGCAGG - Intergenic
1046488776 8:114919663-114919685 GGTACCTGTGCAGGACGTGCAGG - Intergenic
1047259664 8:123244271-123244293 GGGCTGCCTGGAGGAGGTGCTGG - Intronic
1047748093 8:127860188-127860210 GGTCCTGGTGGCGGAGGTGCTGG + Intergenic
1047826172 8:128578842-128578864 GGTCCACATGCAGGATGTGCAGG + Intergenic
1049164608 8:141118184-141118206 GGCCCCAGTGGTGTAGGTGCCGG - Intronic
1049317158 8:141975438-141975460 GGTCACCCAGGAGCAGGTGCAGG + Intergenic
1049668473 8:143859222-143859244 GGTGCCCGTGTGGGACGTGCTGG - Exonic
1049668891 8:143860830-143860852 GGTGCCCGTGTGGGACGTGCTGG - Exonic
1049669306 8:143862432-143862454 GGTGCCCGTGTGGGACGTGCTGG - Exonic
1049669718 8:143864025-143864047 GGTGCCCGTGTGGGACGTGCTGG - Exonic
1049670133 8:143865633-143865655 GGTGCCCGTGTGGGACGTGCTGG - Exonic
1049705632 8:144040778-144040800 GGTGACCGTGGGGGAGGTGGTGG - Exonic
1049738036 8:144220488-144220510 GGTCCCCGTGTAGGAGGAAGAGG - Intronic
1049748755 8:144273831-144273853 GGAGCCCCTGGAGGAGGCGCTGG - Intronic
1049958045 9:711455-711477 GCTCCCCATGGAGGAAGTGGTGG - Exonic
1050308069 9:4326173-4326195 GGTACACGTGCAGGATGTGCAGG - Intronic
1052623339 9:30943349-30943371 GGTACATGTGGAGGATGTGCAGG - Intergenic
1052765377 9:32635089-32635111 GGTCCCGGGGGTGGAGGTGGAGG + Exonic
1053509032 9:38671561-38671583 ATTCCACGTGGAGGAGGTGAGGG - Intergenic
1054711812 9:68518010-68518032 GGTCCAGGTGGAGGAGGATCTGG + Intronic
1055651420 9:78410323-78410345 GGGCGCCGTGGAGCAGGTGGTGG - Intergenic
1058949936 9:109893939-109893961 GGTACACGTGCAGGATGTGCAGG - Intronic
1059845069 9:118266318-118266340 GGTACACGTGCAGGATGTGCAGG + Intergenic
1060599590 9:124869159-124869181 GGAGGCGGTGGAGGAGGTGCTGG + Exonic
1061296956 9:129682018-129682040 GGTCCCTGAGGAGGAGGCGTGGG + Intronic
1061484713 9:130914454-130914476 GGTGGCCCTGGAGGAGGGGCAGG + Intronic
1061670808 9:132187153-132187175 GGCCCCCCTGGGGGAGGAGCAGG + Intronic
1061849011 9:133403716-133403738 GGCCCCCTTGGAGAAGGTCCCGG + Exonic
1061946602 9:133911956-133911978 GGTACACGTGCAGGATGTGCAGG + Intronic
1061949183 9:133926677-133926699 GGGCTTCCTGGAGGAGGTGCTGG - Intronic
1062060312 9:134491942-134491964 GGCCACGGTGCAGGAGGTGCTGG + Intergenic
1062606434 9:137350743-137350765 GTTCCACTTGGAGGAGCTGCGGG - Intronic
1185593143 X:1291749-1291771 GGTCCAGGTGGAGGTGGTACAGG - Intronic
1185593187 X:1291963-1291985 GGTCCAGGTGGAGGTGGTGCAGG - Intronic
1185593211 X:1292088-1292110 GGTCCAGGTGGAGGTGGTGCAGG - Intronic
1185593457 X:1293610-1293632 GGTCCAGGTGGAGGTGGGGCAGG - Intronic
1185593497 X:1293784-1293806 GGTCCAGGTGGAGGTGGGGCAGG - Intronic
1185593518 X:1293870-1293892 GGTCCAGGTGGAGGTGGGGCAGG - Intronic
1185593547 X:1294000-1294022 GGTCCAGGTGGAGGTGGGGCAGG - Intronic
1185593750 X:1294881-1294903 GGTCTCCATGGAGGTGGAGCAGG - Intronic
1185593905 X:1295726-1295748 GGTCTCTGTGGAGGTGGGGCAGG - Intronic
1186058536 X:5678384-5678406 GGTACCTGTGCAGGATGTGCAGG - Intergenic
1188229808 X:27647530-27647552 GGTACATGTGGAGGATGTGCAGG - Intronic
1189037514 X:37507322-37507344 TGTCCCCGGGGTGGAGGAGCGGG + Intronic
1189407102 X:40735309-40735331 GCTCCCGGGGGAGGAGGGGCTGG + Exonic
1190258494 X:48783065-48783087 CATCCCCGTGGAGGGGGCGCAGG - Intergenic
1192468442 X:71375226-71375248 GGTCCCGGGGGTGGAGGTGGAGG - Exonic
1192634593 X:72805528-72805550 GGTCCCCAAGGTGGTGGTGCTGG - Intronic
1192647120 X:72915273-72915295 GGTCCCCAAGGTGGTGGTGCTGG + Intronic
1194367104 X:93025177-93025199 GCTCCTCGGGGAGGAGGTTCTGG - Intergenic
1194960839 X:100233774-100233796 GGTACCTGTGCAGGATGTGCAGG - Intergenic
1195162269 X:102182340-102182362 GATCCCAGAGGAGGAGGTTCAGG - Intergenic
1195166305 X:102223940-102223962 GATCCCAGAGGAGGAGGTTCAGG - Exonic
1195192555 X:102463148-102463170 GATCCCAGAGGAGGAGGTTCAGG + Exonic
1196344784 X:114641758-114641780 GGTACACGTGCAGGATGTGCAGG + Intronic
1196372083 X:114990501-114990523 GGTACCTGTGCAGGATGTGCAGG - Intergenic
1196784742 X:119411841-119411863 GGTACACGTGCAGGATGTGCAGG - Intronic
1197064914 X:122224279-122224301 GCTCCTCGGGGAGGAGGTTCTGG - Intergenic
1197490619 X:127112267-127112289 GGTACACGTGCAGGATGTGCAGG - Intergenic
1197767216 X:130067032-130067054 GGCCCCCATGGAGGGGCTGCTGG - Exonic
1198922681 X:141747780-141747802 GGTACACGTGCAGGATGTGCAGG - Intergenic
1199224495 X:145356723-145356745 GGTCCATGTGCAGGATGTGCAGG + Intergenic
1199486514 X:148354180-148354202 GGTACATGTGGAGGAGGTACAGG - Intergenic
1199576479 X:149317910-149317932 GTTCCTCGGGGAGGAGGTTCTGG - Intergenic
1200223339 X:154402935-154402957 GCTCACCGAGGAGGAGGTGAAGG - Exonic
1200536164 Y:4400269-4400291 GGTACACGTGCAGGATGTGCAGG + Intergenic
1201352184 Y:13055881-13055903 GGTACACGTGGAGGCTGTGCAGG + Intergenic
1202597009 Y:26550730-26550752 GGTACATGTGGAGGATGTGCAGG - Intergenic