ID: 954864516

View in Genome Browser
Species Human (GRCh38)
Location 3:53717546-53717568
Sequence CCTACCATGGAGAAGTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954864507_954864516 27 Left 954864507 3:53717496-53717518 CCACACACTAGTGGGCGTGTTTC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 954864516 3:53717546-53717568 CCTACCATGGAGAAGTGGGATGG 0: 1
1: 0
2: 0
3: 18
4: 188
954864510_954864516 -3 Left 954864510 3:53717526-53717548 CCTCTACTTCCGCTCAGGATCCT 0: 1
1: 0
2: 0
3: 10
4: 101
Right 954864516 3:53717546-53717568 CCTACCATGGAGAAGTGGGATGG 0: 1
1: 0
2: 0
3: 18
4: 188
954864506_954864516 30 Left 954864506 3:53717493-53717515 CCTCCACACACTAGTGGGCGTGT 0: 1
1: 0
2: 0
3: 3
4: 66
Right 954864516 3:53717546-53717568 CCTACCATGGAGAAGTGGGATGG 0: 1
1: 0
2: 0
3: 18
4: 188
954864508_954864516 5 Left 954864508 3:53717518-53717540 CCACATTTCCTCTACTTCCGCTC 0: 1
1: 0
2: 5
3: 33
4: 355
Right 954864516 3:53717546-53717568 CCTACCATGGAGAAGTGGGATGG 0: 1
1: 0
2: 0
3: 18
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954864516 Original CRISPR CCTACCATGGAGAAGTGGGA TGG Intronic
900946157 1:5832425-5832447 CCTTCCCTGGAGAAGGGGGTTGG - Intergenic
904659789 1:32075805-32075827 CCTACCAGGGAGGTGTGGGAGGG - Exonic
905371836 1:37486590-37486612 CCCACTCTAGAGAAGTGGGATGG - Intergenic
906157780 1:43623989-43624011 ACTACCTTGGAGGAGAGGGATGG + Intergenic
906961136 1:50420048-50420070 CCTGCCGTGGAGAAGTGGCCAGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907428458 1:54396471-54396493 CTTAACAGGGAGAAGTGGCAGGG - Intronic
910654414 1:89605415-89605437 CCTACCATGAAGAGGAGGGACGG + Intergenic
910712650 1:90197557-90197579 CCTTCCATGGGGAAGGGGGATGG + Intergenic
910712981 1:90200969-90200991 CCTCCCATGGAGATTTGGCAAGG - Intergenic
911447620 1:98017964-98017986 CTTGCAATAGAGAAGTGGGAGGG + Intergenic
912649484 1:111425203-111425225 CCCACCATGGAGAAGAGGCCAGG + Intronic
914412031 1:147438602-147438624 GCTACCAGGGAGGAGGGGGAAGG - Intergenic
914815827 1:151061302-151061324 GCCACCATGGGGAAGGGGGAAGG - Intronic
915921323 1:159977910-159977932 CCTGCCATGGGGAAAAGGGAGGG + Intergenic
916445907 1:164871560-164871582 CCCATCATGGACAGGTGGGATGG + Intronic
918487011 1:185040292-185040314 CCTCCCATGGAGATTTGGAATGG - Intergenic
921808399 1:219481697-219481719 CCTACCTGGAAGAAGGGGGAAGG - Intergenic
922380672 1:225020961-225020983 TTTACCATGGAGAAGTAGGAAGG + Intronic
1067459416 10:46446388-46446410 CATTCCATGGAGAGGTTGGAGGG + Intergenic
1067627778 10:47938242-47938264 CATTCCATGGAGAGGTTGGAGGG - Intergenic
1067701577 10:48576942-48576964 ATTACCATGGAGATTTGGGAAGG - Intronic
1069348263 10:67495503-67495525 CCTACCCTGGAGGAATGGGCGGG + Intronic
1070354275 10:75624519-75624541 TTTACCATGGAGAAGAGGAATGG + Intronic
1070921090 10:80186820-80186842 CCTGCCATGGAGGAGCGTGACGG - Intronic
1071463564 10:85920492-85920514 CCTACCCAGGAGAATTAGGATGG - Intronic
1071976845 10:90964180-90964202 CCTAGGATGGAACAGTGGGATGG + Intergenic
1074365194 10:112852361-112852383 AGTGCCATGGAGAAGTGGGGAGG - Intergenic
1074411728 10:113234479-113234501 GGTACCATGGAGCACTGGGAAGG + Intergenic
1074815920 10:117140570-117140592 CCTACCCTGGAGGGGTTGGAGGG + Intergenic
1074883036 10:117673168-117673190 CCTCCCATGGACAAGTGAGTGGG - Intergenic
1075680619 10:124328647-124328669 CCTCTCAGGGAGCAGTGGGATGG + Intergenic
1078072566 11:8126658-8126680 CCTTACATGGAGGACTGGGAAGG - Exonic
1079141359 11:17812135-17812157 GTTGCCATGGAGAAGTGGGTTGG - Intronic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1084510839 11:69602635-69602657 TCTATCTTGGAGAAGTGGGGAGG - Intergenic
1085273226 11:75282596-75282618 GCTACCATGGAGGCGTGGCAGGG - Intronic
1085706252 11:78789002-78789024 TCTACCATGTAAAAATGGGAAGG - Intronic
1087080866 11:94169763-94169785 CCTGCCATGGAGACTCGGGAGGG + Intronic
1087740459 11:101881297-101881319 CCAACCACGAAGAAGTTGGAGGG + Intergenic
1088137700 11:106577891-106577913 ACTACCATGGAGGATAGGGAAGG + Intergenic
1088162059 11:106884032-106884054 CCTGTCATGGGGAAGGGGGAGGG + Intronic
1090777127 11:129975544-129975566 CCCACCATGGGGGAGTGGGATGG - Intronic
1091653070 12:2323974-2323996 CCTGCGATGGAGAACTGGAATGG - Intronic
1091671779 12:2457208-2457230 GATACCATGGAGAAGCCGGAGGG + Intronic
1091917018 12:4277011-4277033 CCTACCAGTGAGGAGGGGGAGGG - Intronic
1091952541 12:4606962-4606984 CCCACCATGGAGCACTGGAAAGG - Intronic
1094160360 12:27383598-27383620 CATACCAGGCAGAAGTGGGCTGG - Intronic
1098481762 12:70969890-70969912 CCTGTCAGGGAGGAGTGGGAGGG + Intergenic
1101869923 12:108557685-108557707 CCTTCCATTGAGTAGTGGAAAGG - Intronic
1102345693 12:112159724-112159746 ACTACCATGGAACAGTAGGAGGG + Intergenic
1102748139 12:115268032-115268054 CCTACCAATGAGAACTGGCATGG - Intergenic
1104015622 12:124959931-124959953 CCTGCCCTGGAGCAGGGGGAGGG + Intronic
1105239214 13:18595557-18595579 CCTGCCTTGGAGAAGAAGGAAGG + Intergenic
1113484896 13:110646500-110646522 CCTACCCTGCTGAAGTGGCAGGG + Intronic
1113670210 13:112170995-112171017 CCTGCCAGGGAGAAGTGTGGTGG - Intergenic
1114796169 14:25717674-25717696 CCTGTCATGGAGTAGGGGGATGG - Intergenic
1117744944 14:58860207-58860229 CCTATGATGGTGGAGTGGGATGG + Intergenic
1117940971 14:60964291-60964313 CAGACCTTGGAGAAGAGGGAGGG - Intronic
1118404897 14:65413117-65413139 CCCACGATGGGGGAGTGGGAAGG - Intronic
1118896373 14:69949185-69949207 CGTGCAATGCAGAAGTGGGATGG + Intronic
1119085098 14:71732041-71732063 CCTACCAAGGGTAAGTAGGAGGG - Intronic
1119321121 14:73731080-73731102 CCTAGCAGGGAGAAGTAGGAGGG - Intronic
1120074745 14:80142812-80142834 CCTGCTGTGGAGAACTGGGAAGG - Intergenic
1120700771 14:87696672-87696694 CTTACCATGGAGAAGTTGATAGG - Intergenic
1121940951 14:98070168-98070190 TCTACCAGGAAGAAGGGGGAAGG - Intergenic
1123492037 15:20788527-20788549 CCTGCCTTGGAGAAGAAGGAAGG - Intergenic
1123548541 15:21357617-21357639 CCTGCCTTGGAGAAGAAGGAAGG - Intergenic
1124905042 15:33860329-33860351 CCAACCAGGGAGAAGTAGAAAGG + Intronic
1125098717 15:35885288-35885310 CTTACCTGGGAGGAGTGGGAGGG - Intergenic
1127785985 15:62355102-62355124 CCTACCAAGCAAATGTGGGATGG + Intergenic
1127875982 15:63111663-63111685 GCTGACATGGGGAAGTGGGAGGG + Intergenic
1129797255 15:78387227-78387249 CAGACCTAGGAGAAGTGGGAAGG + Intergenic
1130209713 15:81911914-81911936 GATACTATGGAGAAGTGGTATGG + Intergenic
1131341183 15:91602609-91602631 AATTCCATAGAGAAGTGGGATGG - Intergenic
1132330695 15:101010428-101010450 CCTGCGATGGAGAAGAAGGAAGG - Exonic
1202956875 15_KI270727v1_random:84848-84870 CCTGCCTTGGAGAAGAAGGAAGG - Intergenic
1132661350 16:1062856-1062878 CCTACCATAGGGAAGTGGCCAGG + Intergenic
1135110509 16:19687225-19687247 CCAGCAATGGAGAAGAGGGAAGG - Intronic
1138201422 16:55091474-55091496 CGTCCCTTGCAGAAGTGGGAGGG - Intergenic
1138552109 16:57753762-57753784 CCTGCCAGGGACAAGTGGGCTGG + Intronic
1140015304 16:71176595-71176617 CATCCCATGGAGAGGTGGGGTGG - Intronic
1141088343 16:81112536-81112558 CCTACCTGGGGGAACTGGGATGG - Intergenic
1142471026 17:163350-163372 CCTTCCCTAGAGAAGGGGGAAGG + Intronic
1144674346 17:17152424-17152446 CCTACCAGGGTGAAGTGAGGAGG - Intronic
1149932445 17:60769556-60769578 CCTGCCGTGGGGAAGGGGGAGGG + Intronic
1150249336 17:63697648-63697670 CACACCATTGAGAAATGGGAGGG - Exonic
1153803171 18:8689379-8689401 CCAAGCAGGGAGAAGAGGGAAGG - Intergenic
1153967789 18:10197256-10197278 CCTCCCGAGGAGAAGTGGAAGGG + Intergenic
1157501070 18:48191127-48191149 CCCACCTTGCAGAGGTGGGAGGG + Intronic
1158241202 18:55380219-55380241 CCTCACATGGAGAAGAGAGAAGG + Intronic
1160583525 18:79900746-79900768 CCTGCCATGGAGAAGGGGCTGGG - Intergenic
1160974304 19:1785132-1785154 GCCCCCATGGGGAAGTGGGACGG - Intronic
1163502601 19:17685958-17685980 TCTCCCAGGGAGAGGTGGGATGG - Intronic
1164526533 19:29017321-29017343 CCCTCCATGGAGAAGGAGGATGG - Intergenic
1164545973 19:29163153-29163175 GCTCCCATGGAAACGTGGGAAGG + Intergenic
1166443709 19:42839739-42839761 CCTGCCATGGAGACCTGGCAGGG - Intronic
1168523253 19:57069183-57069205 CCTCCCATGGAGAAGGGGAGCGG - Intergenic
934735035 2:96685779-96685801 CTTCCTATGGAGCAGTGGGAAGG + Intergenic
935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG + Intergenic
935314461 2:101817677-101817699 CTTTCCATGGAGAAGAGGGCGGG + Intronic
937263166 2:120599251-120599273 CCTGCCAGCGGGAAGTGGGAAGG - Intergenic
939698499 2:145358746-145358768 TCTAACAGGGAGAAGTAGGAGGG + Intergenic
941157707 2:161999532-161999554 CCTGGCAAGGAGAAGTGGGAAGG + Intronic
941950109 2:171146787-171146809 TCTAAAAAGGAGAAGTGGGAAGG - Intronic
942375051 2:175328181-175328203 AATCCCATGGAGTAGTGGGAGGG + Intergenic
942746303 2:179237411-179237433 GCTACGATGGAAATGTGGGAAGG - Intronic
944518666 2:200540632-200540654 CCCACCATAGAGGAGAGGGAGGG + Intronic
945017214 2:205531525-205531547 CCCTCCATGGATAAGAGGGATGG + Intronic
946320431 2:218950925-218950947 CCTACCATGGAGTGGTGGGGCGG + Intergenic
946635324 2:221718801-221718823 CCTATCATGGAGTGGGGGGATGG - Intergenic
1170534382 20:17325529-17325551 CCTACCATTGAGTAGATGGAAGG - Intronic
1170920548 20:20674929-20674951 CCTAAAATGGTGAAGGGGGAGGG + Intronic
1171121353 20:22571777-22571799 CCCAGCATCGAGCAGTGGGAAGG - Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1172942213 20:38661923-38661945 CCTACTATGGGGGAGGGGGAGGG + Intergenic
1173185307 20:40835940-40835962 CCTGGCATGGAGAAGGGTGATGG + Intergenic
1174054986 20:47792435-47792457 CCTACCAGAGTGGAGTGGGAGGG - Intergenic
1174419652 20:50391252-50391274 CCTACCAGGGAGAGAGGGGAAGG - Intergenic
1175840288 20:62022261-62022283 CCAAGCATGGAGAGGTGGGAAGG + Intronic
1176139096 20:63537387-63537409 CCTGTCATGAGGAAGTGGGACGG - Intergenic
1176177298 20:63734835-63734857 GCTGCCCTGGAGAAGTGGGCAGG + Intronic
1176446586 21:6827306-6827328 CCTGCCTTGGAGAAGAAGGAAGG + Intergenic
1176824756 21:13692336-13692358 CCTGCCTTGGAGAAGAAGGAAGG + Intergenic
1177190001 21:17840296-17840318 CCTACCATGGGGCAGAGGTAGGG + Intergenic
1180199534 21:46216035-46216057 CCTGCCATGGGGAAGAAGGAGGG - Intronic
1183674298 22:39291076-39291098 CCCACCACGGAGAAGAGTGAAGG + Intergenic
949344378 3:3063329-3063351 CCATCCAAGGAAAAGTGGGAAGG - Intergenic
950106966 3:10394518-10394540 CCTCTCATGGAGAAGAGGCAGGG + Intronic
950341922 3:12254691-12254713 TCTACACTGGAGAAGTGGGAGGG - Intergenic
952455556 3:33468369-33468391 CCTACCAAGGAGAATGGGGCAGG - Intergenic
954864516 3:53717546-53717568 CCTACCATGGAGAAGTGGGATGG + Intronic
958746165 3:98137782-98137804 TTTACCACAGAGAAGTGGGAAGG + Intergenic
960245157 3:115392356-115392378 CCTTCCAGGCAGAAGTGTGATGG - Intergenic
961640161 3:128360154-128360176 GCCACTATGGAGAAGTGGGGAGG - Intronic
961832407 3:129630534-129630556 TCTACTATGGAGAAGTAGGATGG + Intergenic
961935780 3:130582072-130582094 CTGAGTATGGAGAAGTGGGAAGG + Intronic
962596128 3:136945796-136945818 GCTACAATGGACAAGTTGGATGG + Exonic
963060629 3:141222048-141222070 CCTGGCCTGGAGAAGAGGGAAGG - Intergenic
964548235 3:157858640-157858662 CCCATCCTGGAGAAGTGGCAAGG + Intergenic
966810336 3:183838135-183838157 CCTACTCAGGAGAGGTGGGAGGG - Intronic
966896272 3:184447611-184447633 ACCAGCATGGAGAACTGGGAGGG - Intronic
967951913 3:194847777-194847799 AGTTCCATGGAGAAGGGGGAAGG + Intergenic
968807796 4:2786832-2786854 CCAAGGATGGAGAAGTGGAAGGG + Intergenic
973193598 4:47414712-47414734 CTTACCATGGAGAACAGGAATGG - Intronic
979031976 4:115660455-115660477 CATACCAAGGAGTAATGGGATGG - Intergenic
982214053 4:153065012-153065034 CCTCCCGTGGAGCCGTGGGAAGG + Intergenic
982920694 4:161270525-161270547 TCTGCCAAGGTGAAGTGGGAAGG + Intergenic
986476085 5:8134879-8134901 CCTACAAGGGACAAGTGTGACGG - Intergenic
988932702 5:36052569-36052591 CCTACCAGGGATAAGAGAGAAGG - Intronic
994756675 5:103801575-103801597 CTTACCATGGATAATTGGGTTGG + Intergenic
995066018 5:107863875-107863897 CCTGCCATGGTGCACTGGGAAGG - Intronic
995525064 5:113044155-113044177 TCTCCCAAGGAGACGTGGGATGG - Intronic
999956609 5:156709862-156709884 CCTACTCTGGGGAAATGGGAAGG + Intronic
1003442349 6:6154933-6154955 CATACCATGGAGAAGACAGATGG - Intronic
1003479061 6:6514482-6514504 CCTTCCAGTGAGAAGTGGAAGGG - Intergenic
1004021774 6:11782489-11782511 CATATCCAGGAGAAGTGGGAAGG + Intronic
1005700285 6:28393866-28393888 CTTCCCAGAGAGAAGTGGGACGG - Intronic
1007375233 6:41451887-41451909 ACTGGCAGGGAGAAGTGGGAAGG - Intergenic
1011192845 6:84750984-84751006 CTTACCTTGGAGAAGAGGAAGGG - Intronic
1016717421 6:147250631-147250653 CCCAGCATGCAGAGGTGGGATGG - Intronic
1017953966 6:159162664-159162686 TCTTCTATGGAGAAGGGGGAAGG + Intergenic
1018494203 6:164331668-164331690 TCTACCATAGAGATGTGGGTTGG - Intergenic
1020429879 7:8107904-8107926 CCTGCCATGATGCAGTGGGACGG - Intergenic
1020905024 7:14053569-14053591 CTGACCAGGGAGAACTGGGATGG - Intergenic
1023274806 7:38506885-38506907 CCTTCCATGGAAATGTGTGAGGG + Intronic
1024215659 7:47246162-47246184 CCTACCAAGGAGAGGAGGGATGG + Intergenic
1024918710 7:54534306-54534328 CCTCCCAGGGAATAGTGGGAAGG - Intergenic
1025116092 7:56259751-56259773 CCTAGCATGTACAAGTGGGAAGG - Intergenic
1025238001 7:57247700-57247722 CCTACCAGAGTGGAGTGGGAGGG + Intergenic
1025251294 7:57353238-57353260 CCTACCAGGGAGAGAGGGGAAGG + Intergenic
1025255424 7:57381362-57381384 CCTTCCCAGGAGAAGTGGGGTGG + Intergenic
1026200545 7:68210967-68210989 CCTAGCATTTACAAGTGGGATGG - Intergenic
1026724783 7:72862829-72862851 CCTACCTAGGAGCAGGGGGAGGG - Intergenic
1028824300 7:95252073-95252095 GATACCATGGAGAACTTGGATGG + Exonic
1029448304 7:100626980-100627002 CCTAGCATGGGGAAGGGGGCTGG + Intronic
1029518512 7:101043988-101044010 CCTGCCATGGGGTAGGGGGATGG - Intronic
1032144702 7:129368489-129368511 TGCACTATGGAGAAGTGGGACGG + Intronic
1032296126 7:130639971-130639993 CCTACCACTGAGAAAAGGGACGG - Intronic
1033458110 7:141520700-141520722 CCTGCCATGGAGAACAGGGACGG - Intergenic
1034874710 7:154714984-154715006 CCTACCAGGTAAAAGTGTGAGGG - Intronic
1035044715 7:155956101-155956123 CCCACCATGGAGAGCAGGGAGGG - Intergenic
1036857103 8:12305427-12305449 CCTGTCATGGGGTAGTGGGAGGG + Intergenic
1038546693 8:28431183-28431205 CCTGCCATGGTGAAAAGGGAGGG - Intronic
1040459618 8:47634691-47634713 CCCACCATGGCTGAGTGGGAGGG + Intronic
1041000598 8:53446663-53446685 CCTGTCATGGAGTAGGGGGAGGG + Intergenic
1045368113 8:101494175-101494197 CCTGTCATGGAGAAGTGGCGGGG + Intronic
1045956268 8:107911329-107911351 CCTAACCTGGAGAAGTAGCAGGG + Intronic
1049176172 8:141194011-141194033 CCTGCCAGGGAGAAACGGGAGGG - Exonic
1054949435 9:70833918-70833940 GATACCACTGAGAAGTGGGAAGG + Intronic
1056178091 9:84055551-84055573 CCTACCTGGGAGAACTGAGAGGG - Intergenic
1056223004 9:84468342-84468364 GCAACCATGGGGAGGTGGGAAGG + Intergenic
1056942500 9:90967367-90967389 CTGACCATGGTGACGTGGGAAGG + Intergenic
1057558464 9:96108286-96108308 CCTTCCAGGGAGGAGTAGGATGG - Exonic
1059937297 9:119323730-119323752 CCAACAATGGAGAAGTGAGAAGG - Intronic
1061010642 9:127952423-127952445 TCCACCATGGAGAAGAGGGATGG + Intronic
1061609076 9:131734227-131734249 CATGCCCTGGAGAAGTGGAATGG - Intronic
1203522604 Un_GL000213v1:57225-57247 CCTGCCTTGGAGAAGAAGGAAGG - Intergenic
1191734018 X:64369607-64369629 CCTATCATGGAGGAGGGGGCAGG + Intronic
1192809257 X:74535229-74535251 GCTACTGTGGAGAAGTGGCAGGG - Intergenic
1193357667 X:80540556-80540578 CCTACCAGGGATTAGTGGGTAGG - Intergenic
1196033365 X:111115459-111115481 CCCACCATTGTGAAGTGGGATGG + Intronic
1200885606 Y:8265773-8265795 GCTACCATGGAGAAATGTGGTGG + Intergenic
1202198268 Y:22319421-22319443 GCTACCATGGAGAAGTGTGGTGG - Intronic
1202240628 Y:22764175-22764197 GCTACTATGGAGAAATGGGGTGG + Intergenic
1202393614 Y:24397928-24397950 GCTACTATGGAGAAATGGGGTGG + Intergenic
1202477171 Y:25272172-25272194 GCTACTATGGAGAAATGGGGTGG - Intergenic