ID: 954864520

View in Genome Browser
Species Human (GRCh38)
Location 3:53717571-53717593
Sequence CTCAGTATGACTAGGGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954864520_954864524 8 Left 954864520 3:53717571-53717593 CCAGAGACCCTAGTCATACTGAG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 954864524 3:53717602-53717624 CAACCTTGCCCTCTGCTCACTGG 0: 1
1: 0
2: 11
3: 15
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954864520 Original CRISPR CTCAGTATGACTAGGGTCTC TGG (reversed) Intronic
900926824 1:5711234-5711256 CTCATCATGCCCAGGGTCTCTGG - Intergenic
901798624 1:11694386-11694408 CTCAGTATCACAGGGGTTTCCGG - Intronic
904873833 1:33638219-33638241 CTCCATATGCCTAGTGTCTCTGG + Intronic
911742368 1:101400972-101400994 CTCAGTCTGAATAAGGTCACAGG + Intergenic
913568380 1:120096451-120096473 CTCAGTAAGACAAGGGCCTGTGG + Intergenic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1069832188 10:71288134-71288156 GTCAGTATGAATAGGGTCTGTGG - Intronic
1071324599 10:84500208-84500230 GTCAGTAGGTCTAGGGTCACTGG - Intronic
1073008877 10:100345187-100345209 CACAGTGTGACCAGGGCCTCAGG + Intergenic
1080555591 11:33413882-33413904 CTGAATCTGTCTAGGGTCTCTGG + Intergenic
1088305825 11:108406426-108406448 CTAAGTATGACCAGGCTCTGTGG - Intronic
1089103801 11:115985483-115985505 CTCAGTATGCCCTGGGTCTTGGG - Intergenic
1094167217 12:27455086-27455108 CTCAGGATGACCAGGCTGTCAGG + Intergenic
1100886378 12:99075106-99075128 CACAGAATGACTAGATTCTCAGG + Intronic
1103564361 12:121808086-121808108 CTCCCTAGGACTGGGGTCTCGGG + Intronic
1104526377 12:129526895-129526917 TCCAGTATCACTAGGGTCCCAGG - Intronic
1104875844 12:132034234-132034256 CTCAGTATCAATAAAGTCTCAGG + Intronic
1113443488 13:110347592-110347614 CTCAGGATGACTAATGTCACTGG + Intronic
1113776340 13:112947768-112947790 CTCAGTAGGTCTGGAGTCTCAGG + Intronic
1115705869 14:35997765-35997787 CTCAGCAGGACTGGGGTCTAGGG - Intergenic
1119647926 14:76361838-76361860 CACAGCATGACTGGGCTCTCAGG + Intronic
1121838385 14:97112476-97112498 CTCAGGCTGTCTGGGGTCTCAGG - Intergenic
1122075055 14:99230567-99230589 CTTATTCTGCCTAGGGTCTCTGG - Intronic
1132198487 15:99931861-99931883 CTCATCATGCCTAGGGTTTCTGG - Intergenic
1133330570 16:4970717-4970739 CTCAGAATGACTGGCCTCTCCGG - Intronic
1133911539 16:10070583-10070605 CTCAGTGTCACTAGGATCTCGGG - Intronic
1134204089 16:12223097-12223119 GTCATTATGAGTAGGGTTTCTGG + Intronic
1136146205 16:28317941-28317963 CTGAGTATCACCAGCGTCTCAGG + Intronic
1138271610 16:55699757-55699779 CTCTGCATGACCAGGGCCTCTGG - Intronic
1141679617 16:85536601-85536623 CTCAGTGTGACAAGGATCTGAGG + Intergenic
1143752488 17:9038685-9038707 CTCATGATCACTGGGGTCTCAGG + Intronic
1146070804 17:29679334-29679356 CACAGTATGATTATGGGCTCTGG + Intronic
1150415498 17:64984998-64985020 CTCAGGGTGACTGGGTTCTCAGG - Intergenic
1156235828 18:35203870-35203892 CTAAGTATGGCTAGAATCTCTGG + Intergenic
1157491118 18:48124553-48124575 GTGAGGATTACTAGGGTCTCTGG + Intronic
1161268461 19:3375916-3375938 CTCTGTAAGATTGGGGTCTCAGG - Intronic
1166892988 19:46005871-46005893 CAAAGTATGACGATGGTCTCGGG - Intronic
924986795 2:278584-278606 CTCAGTATCATGAGGGTCCCAGG + Intergenic
932737311 2:74263477-74263499 CTCAGTAGGGCTAGTGTCCCTGG + Intronic
933612424 2:84451063-84451085 CTCAGTAGGGACAGGGTCTCAGG - Intronic
938083398 2:128382289-128382311 CTCTTTAGGACTAGGATCTCAGG + Intergenic
938408531 2:131045850-131045872 CTCAGGCTGCCTGGGGTCTCTGG - Intronic
940258118 2:151753833-151753855 CTCAGTATATCTAAGGTCACTGG - Intergenic
948401204 2:237686878-237686900 CCCAGTAAGACTAGGGGCACTGG - Intronic
1169867941 20:10219774-10219796 CTCCGTAAGACCGGGGTCTCAGG - Intronic
1172876787 20:38169372-38169394 CACAGCATGACCAGGCTCTCGGG + Intergenic
1182011535 22:27004999-27005021 TACAGTATGACTAGAGTCTCTGG + Intergenic
954864520 3:53717571-53717593 CTCAGTATGACTAGGGTCTCTGG - Intronic
959837599 3:110938752-110938774 CTGAGTATGAGTATGCTCTCTGG + Intergenic
967155862 3:186691884-186691906 CTCAGGATGACGATGATCTCTGG - Intergenic
969596591 4:8152523-8152545 CTCAGGGTGTCTAGGGTGTCGGG - Intronic
973899849 4:55457677-55457699 TTTAGTATGACTAGAGTCTAGGG - Intronic
974064613 4:57066024-57066046 CTGAGTATCACTAGAGTATCTGG + Intronic
976286157 4:83373272-83373294 CTCAGGATGCTTAGGTTCTCAGG + Intergenic
993955573 5:94228449-94228471 CTCAGTATTACCAAGGACTCAGG + Intronic
996324562 5:122258394-122258416 CACAGTATGACTGAGGTCTGTGG + Intergenic
997137160 5:131338695-131338717 CTCAGTATCTCTAGGATCTTGGG - Intronic
997310526 5:132876450-132876472 CTGAGTATCACTAGAGTTTCTGG + Exonic
999845641 5:155476417-155476439 CTAAGTATGACTAAGATATCTGG - Intergenic
1004027344 6:11831885-11831907 CTCTGTCTTGCTAGGGTCTCGGG + Intergenic
1005288146 6:24351024-24351046 CACAGTATAATTAGGTTCTCAGG + Intronic
1011476868 6:87756944-87756966 CTAAGTAGGACCAGCGTCTCAGG + Intergenic
1017800979 6:157896201-157896223 CTTAGAATGACTAGCATCTCAGG + Intronic
1021112642 7:16713128-16713150 CTCAGTAGGGCTGGGGTCTAAGG + Intergenic
1028994543 7:97085760-97085782 CTCAGTGGGGCTAGGGTCTATGG + Intergenic
1034970084 7:155413359-155413381 CTGATGATGACGAGGGTCTCTGG + Intergenic
1041604063 8:59759532-59759554 CTCATGATGCATAGGGTCTCTGG - Intergenic
1045643077 8:104273126-104273148 CTCCGCATGACTTGGTTCTCTGG + Intergenic
1055709003 9:79038091-79038113 GCCAGTATGACTGGGGTCACAGG + Intergenic