ID: 954865138

View in Genome Browser
Species Human (GRCh38)
Location 3:53722673-53722695
Sequence ATTAGATGCTTGGCATTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954865138_954865146 23 Left 954865138 3:53722673-53722695 CCACTTAATGCCAAGCATCTAAT 0: 1
1: 0
2: 0
3: 4
4: 106
Right 954865146 3:53722719-53722741 GGACCAAGAATTCTTGAAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 122
954865138_954865140 2 Left 954865138 3:53722673-53722695 CCACTTAATGCCAAGCATCTAAT 0: 1
1: 0
2: 0
3: 4
4: 106
Right 954865140 3:53722698-53722720 TCCTAACCCTGAGCCAACCTAGG 0: 1
1: 0
2: 1
3: 15
4: 149
954865138_954865149 28 Left 954865138 3:53722673-53722695 CCACTTAATGCCAAGCATCTAAT 0: 1
1: 0
2: 0
3: 4
4: 106
Right 954865149 3:53722724-53722746 AAGAATTCTTGAAGCTGGAAGGG 0: 1
1: 0
2: 1
3: 33
4: 308
954865138_954865148 27 Left 954865138 3:53722673-53722695 CCACTTAATGCCAAGCATCTAAT 0: 1
1: 0
2: 0
3: 4
4: 106
Right 954865148 3:53722723-53722745 CAAGAATTCTTGAAGCTGGAAGG 0: 1
1: 0
2: 2
3: 30
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954865138 Original CRISPR ATTAGATGCTTGGCATTAAG TGG (reversed) Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
901765892 1:11499917-11499939 GTTAGATGCTAGGCGGTAAGAGG - Intronic
902878562 1:19355784-19355806 ACAAGATGCTTGGCGTAAAGGGG - Intronic
903454910 1:23480807-23480829 ATGAGATGATGGGCATAAAGGGG + Intronic
907514452 1:54984608-54984630 ATTATATGCTAGGCACTGAGGGG + Intronic
908284028 1:62574121-62574143 ATTAGAAACATGGCATTTAGGGG - Intronic
911144269 1:94537556-94537578 ATTAGATGGTTTGCATTTACAGG + Intronic
911171116 1:94772019-94772041 ATTCAATCCTTGGCCTTAAGTGG - Intergenic
912297425 1:108484003-108484025 ATTAGATGCTAGAAATTAATAGG + Intergenic
919230679 1:194769309-194769331 CATAGATGAATGGCATTAAGAGG - Intergenic
920496560 1:206458996-206459018 ATTAGGTGGGTGGCACTAAGTGG - Intronic
921571264 1:216781717-216781739 ATTACATGCTTGGCTTTCTGAGG - Intronic
1064507310 10:16047177-16047199 ATTAGATGTTTGGAATGAAAAGG - Intergenic
1068430774 10:56929681-56929703 ATTAGATACTTGGCACTTTGGGG + Intergenic
1072185182 10:93030898-93030920 ATTAGATTGTTTGCCTTAAGGGG - Intronic
1072839137 10:98751040-98751062 AGTAGATGCTCAGCATTAAGGGG - Intronic
1075078283 10:119366152-119366174 AGTAAATGCTTGGCTTTAATAGG - Intronic
1079596664 11:22258147-22258169 ATTAGATGCTAAGTGTTAAGAGG - Intronic
1080493131 11:32789177-32789199 ATTAAATGCTTAGCCTTAGGGGG + Intronic
1080507164 11:32926263-32926285 TTTAGATGTTTGGCAATAATTGG + Intronic
1085554275 11:77405459-77405481 CTTAGATGATTGGCAATAGGGGG + Intronic
1086643204 11:89186055-89186077 ATTAGATGCATGGCAAAGAGTGG + Intronic
1089447167 11:118562474-118562496 ATTAGATGTAAGGCATTAACTGG + Intronic
1091055001 11:132409570-132409592 TGTAGATGCTTGGCATTCAGTGG - Intergenic
1095616756 12:44199371-44199393 ATTGAAAGCTTGGCATTAATTGG + Intronic
1096754163 12:53784915-53784937 ATTACATGCCTGGCATCTAGTGG - Intergenic
1096762795 12:53856780-53856802 ACTAGATGCTGGGAATTAAATGG - Intergenic
1099967960 12:89470834-89470856 ATTAGTGGCTTGGGATTAAAGGG + Intronic
1104347111 12:128010409-128010431 ATTAAATGCTTGCTATTAAGAGG + Intergenic
1108863744 13:54896567-54896589 ATTACATGCTTGCCAATAGGTGG - Intergenic
1111373453 13:87348190-87348212 AATAGATACTTGGCATTCACTGG + Intergenic
1113051005 13:106212090-106212112 TCTAGATATTTGGCATTAAGTGG + Intergenic
1116820121 14:49619896-49619918 ATAAAATGCCAGGCATTAAGTGG + Intronic
1126691580 15:51292905-51292927 ATTCTCTGCTTGGCATTGAGGGG + Intronic
1127638114 15:60890397-60890419 ATTGCATGCTTGCCATCAAGAGG + Intronic
1129161042 15:73748082-73748104 ATTAGGGGCTTGGCATGCAGTGG - Intronic
1130509583 15:84578077-84578099 ATTAGCTGCTTGGCTTTCTGTGG - Intergenic
1137861847 16:51854766-51854788 ATTAGGTGCTTGGCTTTACTAGG - Intergenic
1142912751 17:3109982-3110004 ATTAGATGCTTAGATTTAATTGG - Intergenic
1148822403 17:50367187-50367209 TTTAGAGGCTTGGCTTTGAGTGG - Intergenic
1154125395 18:11688528-11688550 ATAAGATGCTATGCATTCAGCGG + Intergenic
1154530288 18:15337102-15337124 ATTAGATGCTAGGGATTAGAAGG + Intergenic
1156574356 18:38297344-38297366 AGTTGATGGTTGGCATTAACCGG + Intergenic
1159356869 18:67347088-67347110 ATAGGATGCTTTGCTTTAAGTGG - Intergenic
1164952007 19:32345158-32345180 ATTCGCAGCTTGGCGTTAAGGGG - Intergenic
929063530 2:37948542-37948564 TTTAGATGCTTGTCATTATAAGG + Intronic
931335201 2:61334709-61334731 ATAAGACGCCAGGCATTAAGTGG + Intronic
937028663 2:118720224-118720246 ATGAGCTGCTTGGCAGTAACAGG - Intergenic
946039834 2:216773985-216774007 ATTAGGTGCTTGGCAATGATGGG + Intergenic
1176767119 21:13031355-13031377 ATTAGATGCTAGGGATTAGAAGG - Intergenic
1177510510 21:22081023-22081045 AATAGATGCTTAGGATTAAAAGG - Intergenic
1181632999 22:24161218-24161240 AAGAGATGCTTGGCATGGAGGGG + Intronic
1184927655 22:47654883-47654905 CTGAGATGTTTGGCATCAAGTGG - Intergenic
951912145 3:27761933-27761955 ATTAGATGCTAGGATTGAAGTGG - Intergenic
952011992 3:28910017-28910039 CTTAGACGGTTGGCATTTAGAGG - Intergenic
953833562 3:46323841-46323863 ATAAGATGTTTGTCCTTAAGAGG - Intergenic
954865138 3:53722673-53722695 ATTAGATGCTTGGCATTAAGTGG - Intronic
957051092 3:75412745-75412767 TTTAGATGCTTGGGGTAAAGGGG - Intergenic
957157284 3:76560846-76560868 ATTAGTTGTTTGACATTATGGGG + Intronic
960723917 3:120651153-120651175 ATTTGATGCTTGACATCAACTGG + Intronic
962654638 3:137530945-137530967 ATTAGAAGCCTGGCATTGTGAGG + Intergenic
963366889 3:144346558-144346580 ATTAAATGTTTGGTATCAAGTGG + Intergenic
964831055 3:160885069-160885091 ATTAGACTCTTGGCATGTAGGGG + Intronic
967373770 3:188778062-188778084 ATAAGATACTTGGAAATAAGGGG - Intronic
977588004 4:98796369-98796391 ATTTGCTGCTTGGCATTATTTGG - Intergenic
980637887 4:135533244-135533266 ATAAAATGTTTGGCATTTAGTGG - Intergenic
981815473 4:148826190-148826212 ATTTAATGACTGGCATTAAGTGG + Intergenic
982616825 4:157648531-157648553 ATAATATGCTTGGAATTAACTGG + Intergenic
983893664 4:173058330-173058352 AATACAAGCTTGGCATCAAGCGG + Intergenic
986554485 5:8997842-8997864 ATTAGATGCTTGGGAAAAAATGG - Intergenic
987162845 5:15162610-15162632 ATTAGAAGCTTGGTTTTAACAGG + Intergenic
989331487 5:40264713-40264735 ATTAGAAGTCTGGCAATAAGAGG + Intergenic
989842538 5:46097668-46097690 ATTACATGCATAGCTTTAAGAGG + Intergenic
990072398 5:51800244-51800266 AATACATGATTGGCATTCAGAGG - Intergenic
990663502 5:58045989-58046011 ATTAAATAGTTGGCATAAAGAGG - Intergenic
991229186 5:64311128-64311150 ATTGAATTCCTGGCATTAAGTGG - Intronic
993063437 5:83069258-83069280 AACAGATGCTAAGCATTAAGGGG - Intronic
996241614 5:121210005-121210027 ATTAGATGCATGGTATTCATGGG + Intergenic
997090235 5:130848042-130848064 ATTTAATGCTTGTCATTAATAGG - Intergenic
999119625 5:149199136-149199158 ATGTGTTGCTTGGCATTCAGTGG - Intronic
1000370838 5:160535062-160535084 ATTGGCTGATTAGCATTAAGAGG - Intergenic
1001236415 5:170033278-170033300 ATTAGTTGCTAGGCATTGTGTGG - Intronic
1001322064 5:170690841-170690863 ATCAGATGCTTGGGTTAAAGAGG - Intronic
1008752668 6:54756311-54756333 ATTAGATACTTGGCTCTAATTGG + Intergenic
1010492751 6:76494508-76494530 ATTAGATGCATGGGATTATCTGG - Intergenic
1011759754 6:90549555-90549577 AATAGTTGATTGGAATTAAGTGG + Intronic
1015625281 6:135175279-135175301 ATTGCATGCTTGGTAGTAAGGGG + Intergenic
1016813668 6:148284031-148284053 ATTATATCCTTGGCCTGAAGTGG - Intronic
1017473606 6:154765275-154765297 GTTTGATGCTTGGGATTGAGTGG + Intronic
1020828448 7:13062627-13062649 ATTAGATGCTTGGAAGAAAAAGG - Intergenic
1023417040 7:39943245-39943267 ATTATATGTTTAGCATTTAGAGG + Intergenic
1025094273 7:56085447-56085469 ATTTGATGCTTAGAAATAAGGGG + Intronic
1032210062 7:129905549-129905571 ATTAGATGCTTGGAAGGCAGGGG + Intronic
1033477612 7:141705881-141705903 ACTATATGTTAGGCATTAAGGGG + Intergenic
1033925824 7:146459100-146459122 ATTACATGGTAGGAATTAAGAGG - Intronic
1034378861 7:150671447-150671469 ATTAGCTGATTGGCATTTAATGG - Intergenic
1039088040 8:33799437-33799459 ATTAGATCCTTAGGATTGAGTGG + Intergenic
1039932060 8:42002045-42002067 AGTAGATGCTGGCTATTAAGAGG - Intronic
1041737816 8:61130398-61130420 ATAAAATGCTTGGCATGAATTGG - Intronic
1044287802 8:90429591-90429613 ATTAGATGATTGTCAATATGTGG - Intergenic
1046966753 8:120176244-120176266 ATTAGTTTCTGGGGATTAAGTGG + Intronic
1047580796 8:126213155-126213177 AATAGATGCTTGACAAGAAGAGG + Intergenic
1047920868 8:129633204-129633226 ATAGGCTGCTTGGCATTAAAAGG - Intergenic
1048589098 8:135804506-135804528 AGTAGATGCTGGGGATTCAGTGG + Intergenic
1048976762 8:139677511-139677533 GTCAAATGCTTGGCATTTAGAGG - Intronic
1050741612 9:8826715-8826737 ATACTATGCTTGCCATTAAGGGG - Intronic
1051428298 9:16957004-16957026 TTTAGATGCTTGGCACTAATGGG + Intergenic
1053707994 9:40774825-40774847 ATTAGATGCTAGGGATTAGAAGG + Intergenic
1054417905 9:64895615-64895637 ATTAGATGCTAGGGATTAGAAGG + Intergenic
1056938888 9:90938206-90938228 AGTAGATGCTAGGCACTGAGCGG - Intergenic
1187888955 X:23915330-23915352 ATTAGATGCTAGGAATATAGTGG + Intronic