ID: 954868727

View in Genome Browser
Species Human (GRCh38)
Location 3:53750913-53750935
Sequence TCTCACTTACTCTGGGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954868727_954868731 -8 Left 954868727 3:53750913-53750935 CCCACTACCCAGAGTAAGTGAGA 0: 1
1: 0
2: 0
3: 24
4: 141
Right 954868731 3:53750928-53750950 AAGTGAGAAAGTGCTCCAGCTGG 0: 1
1: 0
2: 0
3: 19
4: 196
954868727_954868732 -7 Left 954868727 3:53750913-53750935 CCCACTACCCAGAGTAAGTGAGA 0: 1
1: 0
2: 0
3: 24
4: 141
Right 954868732 3:53750929-53750951 AGTGAGAAAGTGCTCCAGCTGGG 0: 1
1: 0
2: 0
3: 18
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954868727 Original CRISPR TCTCACTTACTCTGGGTAGT GGG (reversed) Intronic
901347382 1:8558004-8558026 TCTGATTTAGTCTGGGTAATAGG - Intronic
906848527 1:49221878-49221900 ACTCACTTGCTCTGGGTCATTGG - Intronic
910557890 1:88556894-88556916 CCTCACTTACACTTGGAAGTAGG + Intergenic
911409599 1:97486078-97486100 TGTCACATAATCTGGGTATTTGG - Intronic
911439570 1:97908450-97908472 TCTCACTGAATCTGGGTAGAGGG - Intronic
912256120 1:108059628-108059650 TCACACTAATTCTGGGTAGTTGG + Intergenic
913123206 1:115761086-115761108 TGTGACTTACTCAGGATAGTGGG + Intronic
913317053 1:117562453-117562475 TTGAACTTACTCTGGGAAGTAGG + Intergenic
914443124 1:147724077-147724099 TCTCACACAGTCTGGGCAGTGGG + Intergenic
915800106 1:158781868-158781890 TCACAATTACTCTGTGAAGTTGG + Intergenic
918057608 1:181035656-181035678 TCTCACTGACTATTTGTAGTAGG + Intronic
920350655 1:205335874-205335896 CCTCCCTTTCTCTGGGTACTTGG - Intergenic
920431535 1:205922045-205922067 TCTGACTTTGTCTGGGTTGTAGG - Intronic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
922647035 1:227298114-227298136 TCTCTCTTTCTCAGTGTAGTAGG + Intronic
924782468 1:247164686-247164708 TCTAAATTGCTTTGGGTAGTTGG - Intronic
1068131914 10:52905724-52905746 TCTCACTTGATCAGGGTGGTTGG + Intergenic
1069783065 10:70969091-70969113 TGTCACTGACTGAGGGTAGTGGG - Intergenic
1070031108 10:72678240-72678262 TCTCATTTACCCTGTGTGGTGGG - Intergenic
1072570883 10:96656609-96656631 TCTCTCTTACTCAGGGGAGCTGG + Intronic
1072964381 10:99958579-99958601 TCTCATTTTCTCTTGGAAGTTGG - Intronic
1073716121 10:106109268-106109290 TCTCCCTCACTCTGGGTTCTTGG + Intergenic
1077923856 11:6661440-6661462 TCTCATTTACTCAGGGGAGGGGG - Intergenic
1080307037 11:30847928-30847950 TCTCAACTACCCTGGGAAGTTGG - Intronic
1080986400 11:37471989-37472011 TCTCACTGACTATTGGTAGAAGG + Intergenic
1081449461 11:43157974-43157996 TCTGTCTTATTCTGGATAGTAGG + Intergenic
1081450884 11:43169869-43169891 TCTCTCTTATTCTGGATAGCAGG + Intergenic
1081723487 11:45307217-45307239 TCTCTCTTATTCTGGGTGGTGGG - Intergenic
1082168322 11:48971322-48971344 TCTCTCTTATTCTGGATAGTAGG + Intergenic
1082235121 11:49814627-49814649 TCTCTCTTATTCTGGATAGTAGG - Intergenic
1082608814 11:55275598-55275620 TCTCTCTTATTCTGGATAGTAGG - Intergenic
1082826327 11:57582443-57582465 TCTCAGCTACTCAGGATAGTTGG - Intergenic
1086701607 11:89905763-89905785 TCTCTCTTATTCTGGATAGTAGG - Intergenic
1086701787 11:89906914-89906936 TCTCTCTTATTCTGGATAGTAGG + Intergenic
1086704381 11:89937611-89937633 TCTCTCTTATTCTGGATAGTAGG - Intergenic
1086704561 11:89938762-89938784 TCTCTCTTATTCTGGATAGTAGG + Intergenic
1087770917 11:102208955-102208977 TCAAACTTACTCTGGGTGATGGG + Intronic
1090524777 11:127521613-127521635 TGACACTTACTCTTGGCAGTGGG - Intergenic
1093781380 12:23141365-23141387 TGGCACTTATTCTGGGTATTAGG - Intergenic
1094648189 12:32347970-32347992 TCTCTCTTACTGTGGGAAGAAGG - Intronic
1097619980 12:61927578-61927600 TGTAAATTACTTTGGGTAGTAGG - Intronic
1098622899 12:72626382-72626404 TTTCACTATCTTTGGGTAGTGGG + Intronic
1099111646 12:78569269-78569291 TCTCCCTTCCTCTGGGTATGGGG + Intergenic
1099321217 12:81152016-81152038 TCTGACTTAGGCTGGGTTGTTGG + Exonic
1099925387 12:89010416-89010438 TCTCACTTACACTGGGAAAGAGG + Intergenic
1103618776 12:122172997-122173019 TCTCACGTGCTCAGGGTGGTGGG + Intronic
1111116412 13:83783933-83783955 TCTCACCTACTCTTTGTATTTGG + Intergenic
1111810286 13:93090334-93090356 TCTCTCTTATTCTGGATAGTAGG + Intergenic
1111810815 13:93093790-93093812 TCTCTCTTACCCTGGATATTAGG - Intergenic
1114212227 14:20625180-20625202 TCTCACTCGCCCTGGGAAGTGGG - Intergenic
1119887715 14:78157363-78157385 TCTCACTTAAGCTGGCTAGTAGG + Intergenic
1120454461 14:84714661-84714683 TTTCACTGACTCTGGGTGGAAGG + Intergenic
1122275461 14:100588605-100588627 TCTCATTTAATCTGGGGAGTAGG + Intergenic
1127488274 15:59438604-59438626 GGTCACTCACTCTGAGTAGTGGG - Intronic
1127883091 15:63175157-63175179 ACTTACTTATTCTGGGCAGTAGG + Intergenic
1128096869 15:64963489-64963511 TCTCACTGTGTCTGGGAAGTAGG - Exonic
1129010118 15:72408364-72408386 TCTCAGTTCCTTTGAGTAGTAGG - Intergenic
1130173965 15:81548137-81548159 TCACACTAACCCTGGGTCGTAGG + Intergenic
1130780823 15:87038513-87038535 TCTCACTCACTGTGGCTATTAGG - Intergenic
1131877142 15:96820297-96820319 TGTCATTTAATCTTGGTAGTTGG + Intergenic
1132041536 15:98528658-98528680 TCTCTCCTCCTCTGGGTAGAGGG - Intergenic
1132713312 16:1278748-1278770 TCTCTCCAGCTCTGGGTAGTTGG - Intergenic
1137312684 16:47281199-47281221 GCACACTTACTCTGGGAATTTGG + Intronic
1139016888 16:62700412-62700434 TCTCAATTATTCGGGGTAATGGG - Intergenic
1141102648 16:81209288-81209310 TCCCACTTCTTCTGGGCAGTTGG + Intergenic
1144169546 17:12646743-12646765 TATCACTTTCTCTGGCTAATTGG - Intergenic
1147191583 17:38741033-38741055 CCTCACATTCTCTGGGGAGTTGG - Intronic
1147950829 17:44106926-44106948 TCTCACTTACTCTGTGACCTTGG + Intronic
1149062211 17:52435761-52435783 TCTAAACAACTCTGGGTAGTGGG + Intergenic
1155925031 18:31646839-31646861 TCTAACTTATTCTGGGAAGCAGG - Intronic
1159405765 18:68000998-68001020 TTTCAATTCCTCTGGTTAGTTGG - Intergenic
1160130531 18:76221420-76221442 TCTCACTTTCTCTGGGAGGGAGG + Intergenic
1163389930 19:17024619-17024641 TGTCAGTTTCTCTGGGCAGTTGG - Intronic
1166244075 19:41513506-41513528 CCTCTCTTACTCTGGATATTAGG + Intergenic
925240886 2:2326205-2326227 TCTCACTCACTGTGGATAGTGGG - Intronic
927470396 2:23371662-23371684 TCTCACTGACTCCGGGTACAAGG - Intergenic
927894285 2:26771446-26771468 CTTCACTTGCTCTGGGCAGTTGG + Intronic
928515360 2:32039685-32039707 TCTCACTTATTCTAGGTACTTGG - Intronic
931923960 2:67050947-67050969 TCGCACTTGGTCTGGGTAGTGGG - Intergenic
933457039 2:82529818-82529840 TCTCTCTTATTCTGGATAGTAGG - Intergenic
934591123 2:95550986-95551008 TCTCTCTCCCTCTGGATAGTAGG + Intergenic
936678301 2:114740691-114740713 TTTCACTTAGTCTGGTTAGTTGG - Intronic
937839963 2:126514994-126515016 CTGCACTAACTCTGGGTAGTTGG - Intergenic
940320023 2:152366847-152366869 TCTCAGCTACTCAGGGTAGGGGG + Intronic
940865891 2:158817589-158817611 TCTCACTTCCTTTGGGTGGCTGG - Intronic
941521285 2:166547183-166547205 TCTCACTTACTCTTTGTCCTTGG - Intergenic
947835915 2:233175528-233175550 TGTATCTTGCTCTGGGTAGTGGG + Intronic
1170512487 20:17092670-17092692 TCTCGCTACCTCTGGGTAGAAGG - Intergenic
1172067041 20:32228557-32228579 TCTCACTTGTTCTGGTTCGTGGG + Intronic
1174067733 20:47877959-47877981 TCTCACTTACTTTTAGTAATTGG + Intergenic
1181973506 22:26711653-26711675 TCTCACTGACTCTGGGAGGGAGG + Intergenic
1182269147 22:29142584-29142606 TCTCAGGTACTCTTGGGAGTTGG + Intronic
1183116116 22:35693963-35693985 TCTCTCTTATTCTGGATAGTAGG - Intergenic
1183117009 22:35699979-35700001 TCTCTCTTATTCTGGATAGTAGG - Intergenic
1184397384 22:44250908-44250930 TATCACTCACTCTGGGGAGGTGG - Intronic
949991329 3:9581761-9581783 TAACGCTTCCTCTGGGTAGTTGG + Intergenic
950680469 3:14581659-14581681 TCTCTCTTTCTCTGGGCTGTTGG - Intergenic
951765911 3:26198819-26198841 TCTCACTTACTAGGGGTCATTGG + Intergenic
952292157 3:32027743-32027765 TCCCAGTTACTCTGGGGACTTGG - Intronic
952981361 3:38738695-38738717 TCTCACTGACTCTTGGGAATAGG - Intronic
953577629 3:44125993-44126015 TCTCACTTATCCTGTGAAGTTGG - Intergenic
954417254 3:50399356-50399378 TCTCATGTCCTCTGGGAAGTGGG - Intronic
954868727 3:53750913-53750935 TCTCACTTACTCTGGGTAGTGGG - Intronic
955158979 3:56446190-56446212 TCTCACTTACTCTGAATCCTGGG - Intronic
955442658 3:58974048-58974070 TCTCACTTGCTCTGTGTCCTGGG - Intronic
959384883 3:105691695-105691717 TTATACATACTCTGGGTAGTAGG - Intronic
960606632 3:119512639-119512661 TATTACTGACTCTGGGTAATGGG + Intronic
965044880 3:163564306-163564328 TCTCAGTTACTCTTGGAAATAGG + Intergenic
967931571 3:194694093-194694115 TCACACTTGGTCTGGGGAGTAGG - Intergenic
967943518 3:194784496-194784518 CCTCATTTACTCTGGCTTGTAGG + Intergenic
974885685 4:67814238-67814260 TATAAATTACTCTGGGCAGTAGG - Intergenic
976601853 4:86945141-86945163 TCTCAGTTACTCTGGAAGGTAGG + Intronic
980282912 4:130743425-130743447 TCTCAAATACTTTAGGTAGTAGG + Intergenic
982498239 4:156119041-156119063 TCTCACCTAATGTGGGGAGTAGG + Intergenic
984876234 4:184370315-184370337 TGTCATTTACTCTGTGCAGTGGG + Intergenic
986625677 5:9721706-9721728 TTTCTCTTACTTTGGGTAATTGG + Intergenic
988570799 5:32363661-32363683 TCTCATTAAATCTGGGTAATAGG - Intronic
990172967 5:53075662-53075684 TCTCACATACAATGGGAAGTAGG - Intronic
990739460 5:58897473-58897495 TTTCAGTTACTCTGGGCTGTAGG - Intergenic
992479120 5:77133114-77133136 CCTGACTTACTTTGGCTAGTGGG + Intergenic
993505536 5:88704542-88704564 ACTCACTTACTATGGGTGGAGGG + Intergenic
993905115 5:93613917-93613939 TCACACCTTCTCTGGGTACTTGG - Intergenic
994639820 5:102393522-102393544 TCTAACTTATTCTGGGGATTCGG - Intronic
994759668 5:103836763-103836785 TCTCATTTACTCTTGCCAGTGGG + Intergenic
995635560 5:114186375-114186397 TATCAGTTACTCTGGGTTTTGGG - Intergenic
996508036 5:124289379-124289401 TCACACTTTCTCAGGGAAGTGGG + Intergenic
999686281 5:154106074-154106096 TCTCACTTGCTGTGGGGCGTGGG + Intronic
999862903 5:155667556-155667578 TATAACTTACTCTTGGTAGGTGG + Intergenic
1006203137 6:32314820-32314842 TCTCACTTAATCCAGATAGTAGG - Intronic
1006203858 6:32321860-32321882 TCTCACTTAATCCAGATAGTAGG - Intronic
1009369762 6:62883785-62883807 TCTCTCTTCCTCTGGGTATTAGG - Intergenic
1013820893 6:114152728-114152750 TCGCACTTACACTGGGAGGTTGG - Intronic
1015266280 6:131295049-131295071 TCTGACTTGCTCTAGGGAGTTGG + Intergenic
1016394352 6:143606686-143606708 TAACACTCACTCTGGATAGTTGG + Intronic
1020738847 7:11987547-11987569 TCTTACTTATCCTGGGTATTTGG + Intergenic
1021985885 7:26098110-26098132 CCTCATTTACCATGGGTAGTAGG + Intergenic
1022384348 7:29887809-29887831 TCTCAGTAACCCTGGGAAGTGGG + Intronic
1022597709 7:31728431-31728453 TTTCTCTTACTTTGGGTATTTGG - Intergenic
1024801286 7:53083017-53083039 CCTTACTTAGTCTGGATAGTGGG - Intergenic
1025010799 7:55396410-55396432 TCTCCCTTGCTCCGGGTAGGCGG - Intronic
1026546667 7:71329109-71329131 TCTAACTTAATCTGTGTGGTTGG - Intronic
1028005811 7:85566014-85566036 TCCCACTTACTTTGGGCAGGAGG + Intergenic
1029864557 7:103613115-103613137 TTTCAGTAACTCTGTGTAGTAGG + Intronic
1029925201 7:104308525-104308547 TATTTCTTAGTCTGGGTAGTAGG - Intergenic
1031420582 7:121546879-121546901 TCTCCCTTAGTATGGGTAGAAGG - Intergenic
1034878694 7:154747725-154747747 TCTTCCTTACTCTGGGTGGGTGG - Intronic
1036806270 8:11836447-11836469 CCTCACCTCCTCTGGGTTGTGGG - Intronic
1037275104 8:17169690-17169712 TTTCACTTACTCTGGATCTTTGG - Intronic
1039596692 8:38796897-38796919 TCTCACATAGTCTTTGTAGTTGG + Intronic
1039620589 8:38993687-38993709 TGTCACTTGCTCTGGTGAGTTGG - Intronic
1042125149 8:65530752-65530774 TCTCACAGACTCTGGTTAGCCGG + Intergenic
1050587513 9:7128258-7128280 TTTAAATTACTCTGGGTAGCAGG - Intergenic
1050902398 9:10964357-10964379 TCTCTCTTATTCTGGATAGTAGG + Intergenic
1051472710 9:17466723-17466745 TCTCACTTATTCTTGATACTAGG - Exonic
1056927837 9:90849664-90849686 ATTCACTTTCTCTGGGTAGGAGG + Intronic
1058521141 9:105815123-105815145 TCTCTCTTATTCTGGATAGTAGG + Intergenic
1058521940 9:105820434-105820456 TCTCTCTCATTCTGGATAGTAGG + Intergenic
1059209163 9:112495810-112495832 TGTAACTTGCTCTGGCTAGTTGG + Intronic
1060136828 9:121164921-121164943 TCTGACTTACTCTCTGTGGTAGG + Exonic
1061636353 9:131912054-131912076 TCTCAGTTCCTCGGGGTGGTAGG - Intronic
1062490364 9:136802428-136802450 TCTCAGTCTCTCTGGGTTGTTGG + Intronic
1186102979 X:6176314-6176336 AATCACTTACTCAGGGTTGTTGG - Intronic
1187018574 X:15355703-15355725 TGTCACTTTCTTTGGCTAGTGGG + Intronic
1187522994 X:20029699-20029721 TCTAACTTACTCTGTTTATTGGG - Intronic
1187565774 X:20448108-20448130 TCTCACATACTCTCGGTGGTAGG + Intergenic
1201253128 Y:12080743-12080765 TCTCACTAACTCCTGGTGGTTGG - Intergenic