ID: 954869917

View in Genome Browser
Species Human (GRCh38)
Location 3:53760031-53760053
Sequence GTCTGCTGATAGATGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954869909_954869917 30 Left 954869909 3:53759978-53760000 CCATTAGACTTTTATACATAGAT 0: 1
1: 1
2: 0
3: 27
4: 253
Right 954869917 3:53760031-53760053 GTCTGCTGATAGATGGGCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954869917 Original CRISPR GTCTGCTGATAGATGGGCCA GGG Intronic
901209945 1:7519028-7519050 GTCTGGTGATGGATGGGGCAGGG - Intronic
901458063 1:9375153-9375175 GTCTGGTGATAGTTGGGCACGGG - Intergenic
901871504 1:12141389-12141411 GCCTTCTGATAGAGGGGACATGG - Intronic
904345601 1:29866794-29866816 GCTTGCTGATAGATGTGACATGG - Intergenic
907445929 1:54507721-54507743 GGTGGCTGATAGATGGGCCTGGG + Intergenic
910506485 1:87955215-87955237 GTCTGCTGATAGATGTACACTGG + Intergenic
912698943 1:111861807-111861829 GTCCGCTGATAGATGGCATAAGG - Intronic
919400099 1:197103514-197103536 GTCTGCTTTTAGAATGGCCAAGG - Exonic
920669263 1:207990880-207990902 GTCTGCATAGAGATGGGGCAGGG - Intergenic
921841163 1:219830083-219830105 GTTTGCTGATGGATGGGCTGTGG - Intronic
1062999385 10:1900279-1900301 GTCTGGGGATAGCTGGGCCCAGG - Intergenic
1067725368 10:48766720-48766742 GTCAGCTGATAATTAGGCCAGGG - Intronic
1067828511 10:49596667-49596689 CTCTGCTGAGAGATGGACCTTGG + Intergenic
1069722520 10:70558976-70558998 GTCTGGTGATAGCTGGGCACTGG + Intronic
1071418315 10:85462343-85462365 GTGTGCTGATTCATGGGCAATGG - Intergenic
1071777921 10:88809908-88809930 GTTGGCTGAAAGAAGGGCCAAGG - Intronic
1072518262 10:96208087-96208109 GTCTGCTGACAGATGGGGAAGGG + Intronic
1072569413 10:96645564-96645586 GTCTGTGGAAAGGTGGGCCATGG + Exonic
1073441717 10:103556259-103556281 GTCTGCTGCCACATCGGCCATGG - Intronic
1075913492 10:126146534-126146556 GTCTGGTGATAGCTGGGCACAGG - Intronic
1076412041 10:130258772-130258794 GTCTGGTGATAGCTGGGCACAGG + Intergenic
1077008800 11:370988-371010 GTCTGCTGATAGCTGGGGTGGGG - Intronic
1078558794 11:12353105-12353127 ATCTGCTACTACATGGGCCAAGG - Intronic
1080637299 11:34135163-34135185 GTTTGCTCCTAGATGGGCTATGG + Exonic
1081732753 11:45383209-45383231 GTCTGCTGAGAGATCAGCAAAGG - Intergenic
1082874724 11:57976922-57976944 GTTTGATGAGAGCTGGGCCAGGG + Intergenic
1085505064 11:77053851-77053873 GTCTGGTGATAGCTGGGCACAGG + Intergenic
1085887399 11:80536555-80536577 GTTTGGTGATTGAAGGGCCATGG - Intergenic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1088783690 11:113161741-113161763 TTCTGCTGAATGATGGGCAAAGG - Intronic
1090074589 11:123572232-123572254 GACTGGTGTTAGATGGGCTATGG - Intronic
1090482029 11:127077488-127077510 GTCTTTTGATAGACTGGCCAGGG + Intergenic
1101033240 12:100680109-100680131 GTCTGCTGAGGTATGTGCCAGGG - Intergenic
1104840633 12:131823474-131823496 GTCTGCTAATGCATGGGTCATGG + Intergenic
1105594646 13:21825753-21825775 CACTGCAGATAGATGGCCCAGGG - Intergenic
1107147083 13:37070532-37070554 CTCTGCTGGTAGCTGGACCATGG + Intergenic
1109275262 13:60297105-60297127 GTTTGCTGAAAGATTGGCTATGG - Intergenic
1110373717 13:74768233-74768255 CTCTGCACATAGAGGGGCCAGGG - Intergenic
1113854874 13:113437682-113437704 GTCTGCAGATAGAGCAGCCATGG - Intronic
1119308885 14:73630229-73630251 GTCTGGTGATAGTTGGGCGGAGG - Intergenic
1120998918 14:90437390-90437412 GTCTGCTGCTGGGTGGGCAAAGG + Intergenic
1121783940 14:96640506-96640528 CTCTCCTGAAAGCTGGGCCATGG - Intergenic
1121945849 14:98121056-98121078 CACTGCTGACAGATGAGCCAAGG - Intergenic
1124662480 15:31561524-31561546 GGGTGCTGATTGATGGGCCCGGG - Intronic
1127197846 15:56609204-56609226 GTCTGATGATAGTTGGACCCAGG - Intergenic
1128113718 15:65092663-65092685 GTCTGCTGATGTCTGGGTCAAGG - Intergenic
1128120074 15:65139280-65139302 GTCTGGTGATAGCTGGGCACAGG - Intergenic
1128530242 15:68440206-68440228 GTCTGCTGAGAGGTGGTCCAGGG - Intergenic
1128548488 15:68583074-68583096 GCCTGCAGAAAGAGGGGCCAGGG - Intronic
1141664879 16:85460899-85460921 GTCTGATGACAGATGGGAAAGGG + Intergenic
1142298727 16:89243845-89243867 GTCTGCTGACAGAGGGGCAGCGG + Intergenic
1143410538 17:6705764-6705786 GACTCCTGATGGCTGGGCCAAGG + Intronic
1144822984 17:18088397-18088419 GTCTCCTGATGGCTGGGCCTGGG + Intronic
1145023790 17:19452672-19452694 ACCTGCTGGTATATGGGCCACGG - Intergenic
1145993285 17:29091855-29091877 CTCTGCCGATGGATGGGCCGTGG + Intronic
1147445110 17:40470391-40470413 GTGTGCTGAGTGCTGGGCCACGG - Intergenic
1150941137 17:69695888-69695910 GTCTGGTGATAGCTGGGCGCCGG + Intergenic
1152123350 17:78432372-78432394 GTCTGCCGGTCGATGGGGCAGGG - Intronic
1152217998 17:79045576-79045598 CTCTGCTGAAAGTTGTGCCAGGG + Intronic
1152490529 17:80629966-80629988 GTCTGCTGATAAACCAGCCAAGG + Intronic
1153638433 18:7133679-7133701 GTCTGCATATAGATGACCCAGGG + Intergenic
1156814744 18:41296273-41296295 GTCTGTTGATGCCTGGGCCAAGG + Intergenic
1157724580 18:49954259-49954281 GTCTACTTAGAGAGGGGCCAAGG + Intronic
1157769496 18:50333420-50333442 GTCTGGTGATAGCTGGGCACAGG + Intergenic
1157770151 18:50338652-50338674 GTCTGGTGATAGCTGGGCACGGG + Intergenic
1159108553 18:64030158-64030180 CTGTCCTGATAGGTGGGCCATGG + Intergenic
1163297038 19:16419072-16419094 ATGTCCTGAAAGATGGGCCAAGG + Intronic
1163640863 19:18461288-18461310 GTCTGCTGACACACGGGCCGTGG - Intronic
1165145223 19:33726173-33726195 GTGTGGTGGTAGATGGGGCAGGG + Intronic
1165281899 19:34804874-34804896 GTCTGGTGATAGGTGGGCACAGG - Intergenic
1165663036 19:37598856-37598878 GCCTGCTTATAGAGAGGCCAGGG + Intronic
1167141043 19:47650992-47651014 GTTTGCAGATGGATTGGCCAAGG - Intronic
1167578136 19:50327603-50327625 GTCTTCTGGGAGACGGGCCACGG + Intronic
1168577941 19:57528563-57528585 GCCTGCAGATAGGAGGGCCATGG + Intronic
926109772 2:10174343-10174365 CTCTGCTGACAGCAGGGCCAGGG - Intronic
928292467 2:30051526-30051548 GTCTGCTGACTAATGGGCAAAGG - Intergenic
928823486 2:35391529-35391551 GTCTGCTGAGAGCTGGACCCTGG - Intergenic
932514467 2:72330967-72330989 GTCTGCTGCTAGATTGGCTAGGG - Intronic
934699345 2:96427348-96427370 GTCTGGTGATAGCTGGGCACAGG - Intergenic
938311900 2:130296243-130296265 GTCTGGTGATAGCTGGGCACAGG + Intergenic
938341461 2:130539254-130539276 GTCAGCTGAGAGCTGGCCCATGG + Exonic
939693634 2:145296879-145296901 TTCTGCTGATAAAAGGGGCAAGG - Intergenic
941099705 2:161282306-161282328 GTTGGCTGGTAGATTGGCCAGGG - Intergenic
945798425 2:214393332-214393354 ACCTGGTGATAGATGGGACATGG - Intronic
947095076 2:226557440-226557462 GTCTGGTGATAGGTGGGCACAGG - Intergenic
947914425 2:233822342-233822364 GTCTGCAGAGAGAAGGTCCAGGG - Exonic
1168769667 20:407543-407565 ATCTGCTGATCGATGGGACGAGG + Intronic
1168920692 20:1533258-1533280 GTCTACTGATAGATGGCGCTGGG + Intergenic
1168978903 20:1988507-1988529 GTCTGATTAGGGATGGGCCAAGG + Intronic
1169066081 20:2694634-2694656 CTCTGCTGACAGCTGGGACAGGG + Intronic
1169316008 20:4591920-4591942 GGCTGCGGGTAGATGGGCCATGG - Intergenic
1169532299 20:6498710-6498732 GTCTTCTGAAAGATGGGGAAGGG - Intergenic
1170465092 20:16615456-16615478 GTCTGCCCATACATAGGCCAGGG + Intergenic
1171870236 20:30519357-30519379 GTTGGCTGGTAGATTGGCCAGGG + Intergenic
1171933612 20:31251910-31251932 GTCTGGTGATAGCTGGGCTCAGG + Intergenic
1172531718 20:35635623-35635645 GTCTTCAGGTATATGGGCCAAGG - Intronic
1172624261 20:36338178-36338200 GTCTGCTGAGAGCTGGGCACTGG + Intronic
1172737046 20:37134614-37134636 GTCTGGTGATAGTTGGGCACAGG - Intronic
1174368055 20:50068296-50068318 GGATGCTGACAGATGGGCCATGG + Intergenic
1174723073 20:52834358-52834380 GTTTGCTGATGGATTGGACATGG - Intergenic
1175143169 20:56875488-56875510 GGCTGCTGAGAGATGGGCCTGGG - Intergenic
1177521696 21:22235377-22235399 GGCTGCTGATAGATTGGGAATGG - Intergenic
1180352143 22:11814371-11814393 GTGGGCTGGTAGATTGGCCAGGG + Intergenic
1180353338 22:11821182-11821204 GTGGGCTGGTAGATTGGCCAGGG - Intergenic
1180386063 22:12177695-12177717 GTGGGCTGGTAGATTGGCCAGGG - Intergenic
1180790098 22:18571142-18571164 GTCTTCTGGTAGATGGGCTGGGG - Intergenic
1181231641 22:21424173-21424195 GTCTTCTGGTAGATGGGCTGGGG + Intronic
1181247010 22:21510695-21510717 GTCTTCTGGTAGATGGGCTGGGG - Intergenic
1183269797 22:36853917-36853939 GTCTTCTGATACATGGGTCAGGG + Intergenic
1184089081 22:42283190-42283212 GTCTGCTGCGAGTTGGGCGATGG - Intronic
1184300218 22:43554255-43554277 GTCTGGTGATAGCTGGGCGCAGG - Intronic
1185088896 22:48755181-48755203 GCCTGCTGAGAGGTGTGCCAGGG - Intronic
1185110571 22:48898052-48898074 GTCTGCAGACGGATGGTCCAGGG + Intergenic
1185126806 22:49015657-49015679 TGCTGCTGATAGGTGGGCCTGGG + Intergenic
950009429 3:9712455-9712477 GTCTGGGGTTAGGTGGGCCAGGG - Intronic
950195622 3:11007210-11007232 GACAGCTGGGAGATGGGCCATGG - Intronic
950303986 3:11904480-11904502 TTCTGCTGATACAAGAGCCATGG - Intergenic
952197641 3:31092890-31092912 GTCAGATGATAGCTGGGCCTGGG - Intergenic
952761964 3:36923021-36923043 GTCTGGTGATAGTTGGGCAATGG - Intronic
952762548 3:36927442-36927464 GTCTGGTGATAGTTGGGTGAAGG - Intronic
953367053 3:42354010-42354032 GGCTGCTGGGAGATGGGCCAAGG - Intergenic
954869917 3:53760031-53760053 GTCTGCTGATAGATGGGCCAGGG + Intronic
956186283 3:66565489-66565511 GTCTGGTGATAGCTGGGCTCAGG + Intergenic
961266429 3:125646800-125646822 GTCTGGTGATAGCTGGGCACAGG + Intergenic
966925255 3:184640423-184640445 GTATTCTGAGAAATGGGCCATGG + Intronic
968041247 3:195591114-195591136 CTCAGCTGGGAGATGGGCCAGGG + Intergenic
970401021 4:15717944-15717966 GTCTGGTGATAGGTGGGCATGGG + Intronic
974881027 4:67757347-67757369 GTCTGGTGATAGTTGGGCATAGG + Intergenic
976734758 4:88298220-88298242 GTCTGCTGATAGCTGGGTGCGGG - Intergenic
981083252 4:140656458-140656480 GTCTGGTGATAGCTGGGCGCAGG - Intronic
983434563 4:167696084-167696106 ATCTGCTAATGGATGGGGCATGG - Intergenic
984726958 4:183030863-183030885 GTCTGGTGATAGCTGGGCGCAGG + Intergenic
988499364 5:31771542-31771564 GTCTGCTGTTGGATTGGCCAGGG + Intronic
999456481 5:151720606-151720628 GTCTGGTGATAGTTGGGCACAGG + Intergenic
1005529346 6:26687143-26687165 ATCTTCTCATTGATGGGCCAGGG - Intergenic
1005541450 6:26814503-26814525 ATCTTCTCATTGATGGGCCAGGG + Intergenic
1006217470 6:32457241-32457263 GTCTGATGATAGTTGGGCACGGG - Intergenic
1009012256 6:57856565-57856587 ATCTTCTCATTGATGGGCCAGGG + Intergenic
1010982514 6:82385220-82385242 GGCTCCAGATAGATGGTCCAGGG + Intergenic
1011559231 6:88598297-88598319 GTGTGATGATAGGTGGGTCAGGG + Intergenic
1013629245 6:111969465-111969487 GCCTGCTGGAACATGGGCCAGGG - Intergenic
1016750498 6:147626024-147626046 GTCTTCTGATTGATGGGGCAGGG + Intronic
1018630289 6:165816431-165816453 GTCTGTTGAGAGAAAGGCCACGG + Intronic
1019856462 7:3613274-3613296 CTCTGCAGATAGATGGGTCATGG + Intronic
1021867363 7:24971470-24971492 GTCTGCTGCGAGATGTGTCATGG - Intronic
1023073252 7:36458593-36458615 CTCTCCTGATAGATGGACCATGG - Intergenic
1023808396 7:43891507-43891529 GTCTGATGATAGCTGGGCGCAGG - Intronic
1025062515 7:55822952-55822974 GTCTGCTGATAGCTAGGCACAGG - Intronic
1027988203 7:85322474-85322496 TTCTCCTGATAGATGGCCCTAGG - Intergenic
1029420246 7:100468275-100468297 GTCAGCTGGTGGCTGGGCCAGGG + Intronic
1031587720 7:123552783-123552805 GTCTGATGATAGCTGGGCACAGG - Intronic
1031601839 7:123719571-123719593 GTCTGCTGATAGCTGAGCTCAGG - Intronic
1032711369 7:134463272-134463294 GTCAGCTGTTTGATGGGCTAGGG - Intergenic
1038528037 8:28293979-28294001 GTCTGGTGATAGCTGGGCACAGG - Intergenic
1038887136 8:31675990-31676012 GACTGCTTATAGATTAGCCACGG - Intronic
1040600385 8:48878240-48878262 ATCTGCTGCTGGATGGGCCCTGG - Intergenic
1042502205 8:69521818-69521840 GGTAGATGATAGATGGGCCAAGG + Intronic
1048917457 8:139198702-139198724 GTCTGCACAGAGATGGTCCAGGG + Intergenic
1050626076 9:7504770-7504792 ATTTGCTGATAGATTGGACATGG + Intergenic
1051722213 9:20049119-20049141 GTCTGTTGCTAGATAAGCCAAGG - Intergenic
1056313701 9:85368577-85368599 CTCTGCTGGTTGATGGGCCTGGG - Intergenic
1058706646 9:107642999-107643021 GGCTGCTTATAGCTGGCCCATGG - Intergenic
1058903269 9:109460237-109460259 GTTTGCTGATAGATGGGATTTGG - Intronic
1060943791 9:127558144-127558166 GTCTGCGCATAGACGGGCCTGGG + Intronic
1061328822 9:129879783-129879805 GGCGGCTGAGAGATGGCCCAAGG + Intronic
1061511976 9:131067173-131067195 GTCTGCGGGTCGAGGGGCCAGGG - Exonic
1062077215 9:134597255-134597277 GTCTGCTGAGAGCTGGGGCTGGG - Intergenic
1203568071 Un_KI270744v1:108517-108539 GTTGGCTAGTAGATGGGCCAGGG + Intergenic
1203569710 Un_KI270744v1:119760-119782 GTGGGCTAATAGATTGGCCAGGG + Intergenic
1193197546 X:78651705-78651727 GACTGCTGTTATATGTGCCAGGG + Intergenic
1196764836 X:119234056-119234078 GTCTGGTGATAGCTGGGCATGGG + Intergenic
1199552316 X:149073811-149073833 GACAGCAGATAGATGGGACATGG - Intergenic