ID: 954869953

View in Genome Browser
Species Human (GRCh38)
Location 3:53760260-53760282
Sequence CTGTCCTAACAGCTGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954869953_954869957 13 Left 954869953 3:53760260-53760282 CCCTACTCCAGCTGTTAGGACAG 0: 1
1: 0
2: 2
3: 10
4: 129
Right 954869957 3:53760296-53760318 ATCTTCTATACTGTCGCAAAAGG 0: 1
1: 0
2: 0
3: 12
4: 105
954869953_954869959 30 Left 954869953 3:53760260-53760282 CCCTACTCCAGCTGTTAGGACAG 0: 1
1: 0
2: 2
3: 10
4: 129
Right 954869959 3:53760313-53760335 AAAAGGCTGTGGTTCTGCAGTGG 0: 1
1: 0
2: 3
3: 13
4: 247
954869953_954869958 19 Left 954869953 3:53760260-53760282 CCCTACTCCAGCTGTTAGGACAG 0: 1
1: 0
2: 2
3: 10
4: 129
Right 954869958 3:53760302-53760324 TATACTGTCGCAAAAGGCTGTGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954869953 Original CRISPR CTGTCCTAACAGCTGGAGTA GGG (reversed) Intronic
900364724 1:2306435-2306457 GTGTCCTAGCAGGTGGAGGAGGG + Intronic
901787530 1:11634556-11634578 CTGCCCTCACAGAGGGAGTATGG - Intergenic
901870001 1:12132947-12132969 CTGTCCTCCCAGCTGGAAAATGG - Intronic
904868642 1:33602462-33602484 CAGTCCTGGGAGCTGGAGTACGG + Exonic
905748574 1:40440947-40440969 CTGTCGTACAAGCTGGAGTGTGG + Intergenic
908342047 1:63191635-63191657 CTGTCCAAACAGATGGACAAGGG - Intergenic
912480290 1:109977835-109977857 CTGTCCTCACTGCTGCAGAATGG + Intergenic
916511169 1:165473622-165473644 ATGGCCTAGCAGCTGGAGTGAGG + Intergenic
917968832 1:180194695-180194717 CTGCCCTAGCAGTTTGAGTAAGG - Intronic
918586167 1:186191341-186191363 CTTGCCTGACAGCTGGACTATGG - Intergenic
1065016624 10:21468297-21468319 CTCTCCTAACAAGTGGAGCAGGG + Intergenic
1067412979 10:46080803-46080825 CTGGCCTAACATCTGAAGGATGG - Intergenic
1070279118 10:75036082-75036104 CTTTCCCAAGAGCTGGAATATGG + Intergenic
1070390733 10:75968213-75968235 CTGTCCTTACAGCTCTAGTGGGG - Intronic
1072798080 10:98371961-98371983 CTCTCCTAACACCTCGAGTGTGG - Intergenic
1073191807 10:101656656-101656678 TTGTTCTAAAAGCTGGATTATGG + Intronic
1075821908 10:125321779-125321801 CTGTCCTAAGTGCTGGGGTATGG - Intergenic
1075955190 10:126517518-126517540 CTCTCCCAATAGCTGGGGTATGG - Intronic
1076992189 11:281259-281281 CTGTCCTACCTGCTGGAGGACGG + Exonic
1078157287 11:8809855-8809877 CTTTCCTAAGAGGTGGAGGAGGG - Intronic
1078889570 11:15542367-15542389 GTGACCTGACAGCTGAAGTAGGG + Intergenic
1079131568 11:17749798-17749820 CAGCCCCAACACCTGGAGTATGG + Intronic
1080916567 11:36666319-36666341 CTGTCCCAACAGCAGGAAAACGG + Intergenic
1081197981 11:40184853-40184875 CTGTCCTAAGAGGTGGAAAATGG - Intronic
1081741413 11:45443580-45443602 CTCTCCCAACAGCTGGATTTTGG - Intergenic
1083606600 11:63982647-63982669 CTGCCCAGACAGCGGGAGTAGGG - Intronic
1084082617 11:66838613-66838635 CTGTCCTAACATCTTGGGGAGGG - Intronic
1084732856 11:71084547-71084569 CTGTTCTAGCACCTGGAGAATGG - Intronic
1086949036 11:92872340-92872362 CTCTCCTCACAGCTGGTTTAAGG + Intronic
1087013977 11:93538590-93538612 CTCTGCTAACAGCTAGAGAAAGG - Intronic
1089545929 11:119225433-119225455 CTGTCCTACAGGCTGGAGTGTGG + Intronic
1090026848 11:123174988-123175010 CTGTCACGCCAGCTGGAGTATGG + Intronic
1091604455 12:1938054-1938076 CTCTCCCAACAACTGGAGCATGG + Intergenic
1093462090 12:19416143-19416165 CTGTCACTAAAGCTGGAGTACGG - Intronic
1096736571 12:53660197-53660219 ATCTCCCAACATCTGGAGTAGGG - Intronic
1105890333 13:24678014-24678036 CTGTCCCAATAGTTGGAGCAGGG + Intergenic
1106925041 13:34605148-34605170 CTGTGCTCACAGCAAGAGTAAGG + Intergenic
1112779416 13:102882780-102882802 GTGTACTAACAGCTGGAGAGAGG - Intergenic
1113579284 13:111417477-111417499 CTGTCCAGACAGCTGGACTCCGG - Intergenic
1120528152 14:85601476-85601498 CTGTCCTAGCAGCTGGTGAATGG + Intronic
1120564318 14:86036101-86036123 TGTTCCTAACAGCTGGGGTATGG + Intergenic
1121478681 14:94239756-94239778 CTGTCTTAATAGCTGGTATAAGG - Intronic
1122389202 14:101368775-101368797 CTGTCCTAAGGGCTGGTGTGGGG + Intergenic
1124111161 15:26789946-26789968 CCGTCTTAACAGCTGGAGGAAGG - Intronic
1125748809 15:42014941-42014963 TTGTCCTAACAACTGGGGTGTGG + Intronic
1132775677 16:1592598-1592620 CTGTCCTAACACGTGGTGTTGGG - Intronic
1135109333 16:19678446-19678468 CAGTGCCAACAGCTGAAGTAAGG - Intronic
1141932538 16:87215748-87215770 CTCTCCTAACACCTGCAGAAAGG - Intronic
1148906999 17:50918325-50918347 CTGTCCTCAAAGCTGCAGTCAGG - Intergenic
1150706162 17:67489262-67489284 CTGTCCTCACAGATGTGGTATGG + Intronic
1151602032 17:75111897-75111919 CTGCTCTAAATGCTGGAGTATGG + Intronic
1158416260 18:57251983-57252005 CTGCCCTAACAGCTAAAGTAGGG - Intergenic
1158706962 18:59801460-59801482 CTGTCCCCCAAGCTGGAGTACGG + Intergenic
1158730782 18:60020223-60020245 CTGTGCTAACAGCAGCAGTTAGG - Intergenic
1162017522 19:7853484-7853506 CTGGCCTAACAGGTGAAGGACGG - Intronic
1163223337 19:15937264-15937286 CTGTCCTTGCAGAGGGAGTAGGG - Intergenic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1166112402 19:40630670-40630692 CAGTCCTGACAGCTGGAGGCGGG + Intergenic
1167500614 19:49845033-49845055 CTGTCCTCTCAGCTTGAGTGTGG - Intergenic
925990742 2:9252169-9252191 CAGTCCTAGCAGCTGGTGTCAGG - Intronic
926564008 2:14450010-14450032 GTCTCCTGACAGCTGGAGAATGG - Intergenic
929650529 2:43676319-43676341 CTGTCCTAACGCCTGGAAAATGG - Intronic
929743965 2:44636176-44636198 CTATCCAAAAAGCTGGACTAAGG + Intronic
930566246 2:53024053-53024075 CTGTCCTAATAACTGGAATCGGG + Intergenic
932232469 2:70094201-70094223 ATGGCCTAACAGCTGGAGGCAGG - Intergenic
938090731 2:128432939-128432961 CTGTCCCCCAAGCTGGAGTATGG + Intergenic
1173941510 20:46914926-46914948 CTGCCTTCAAAGCTGGAGTATGG + Intronic
1176295189 21:5068253-5068275 CTGTCATCCCAGCTGGAGTGCGG + Intergenic
1177394430 21:20513886-20513908 CTGCCCTAAGAACTGGAGGACGG + Intergenic
1179190355 21:39117618-39117640 CTGTCCTAACAGCAGCAGGGTGG - Intergenic
1179861860 21:44193875-44193897 CTGTCATCCCAGCTGGAGTGCGG - Intergenic
1181752235 22:24996838-24996860 CTGTCATAGCAGCTGGGGGATGG + Intronic
1185297450 22:50061334-50061356 GTGTCGTAACAGCAGGAGCATGG - Exonic
950181104 3:10914067-10914089 CTGTCCCACCAGCAGGGGTATGG - Intronic
950328862 3:12139759-12139781 CTTACCTAACAGGTAGAGTATGG + Intronic
951292745 3:20893606-20893628 CTGTCCTAAGACCTAGAATAAGG + Intergenic
951340082 3:21474927-21474949 CTGTACAAACAGCTAGAGAAAGG - Intronic
952720466 3:36526915-36526937 CTATCCTAATAGCTGTAGCAAGG - Intronic
953468923 3:43150239-43150261 GTGACCCAACAGCTGGGGTATGG + Intergenic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
960026360 3:113015265-113015287 CTGTTCTAAGAACTGGATTATGG + Intronic
961491209 3:127257863-127257885 CTGCCCTGACAGCTGGAGGCTGG - Intergenic
962746644 3:138401992-138402014 CTGTCCTGGCCGCTGGAGGAGGG - Intronic
963785978 3:149534829-149534851 CTTTCCTAGCAGCTGGAGGACGG + Intronic
965398410 3:168188768-168188790 CTGTCTTAGGAGCTGGGGTAAGG + Intergenic
968679605 4:1908045-1908067 CTGTGCTAAGAGCAGGTGTAGGG + Intronic
975498201 4:75057503-75057525 CTGTCCCACCAGCTGGATAAAGG - Intergenic
977124612 4:93149668-93149690 CTGTCACCAAAGCTGGAGTATGG + Intronic
979252551 4:118580578-118580600 CTTTCCCAACAGCTGGATGAGGG + Intergenic
982284444 4:153720345-153720367 ATTTCCAAACAGCTGGAGTTTGG + Intronic
984996745 4:185439338-185439360 ATGTCCTACAAGCTGGAGAAAGG + Intronic
988336894 5:29919526-29919548 ATGTCCTTACAGCTGAGGTAGGG - Intergenic
990306075 5:54495026-54495048 CTTTCTCAACAGATGGAGTAGGG + Intergenic
992913819 5:81426749-81426771 CTGTCTTAACAGTTGGAAGAGGG - Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1007468691 6:42073962-42073984 CTGTGCTAACAGATTGGGTATGG + Intronic
1007593592 6:43038082-43038104 CTGTCCTAGCAGCTGGTGGTTGG - Intronic
1008972563 6:57386644-57386666 CTGTCCTGACAGCTGTGGAAAGG + Intronic
1009161471 6:60288192-60288214 CTGTCCTGACAGCTGTGGAAAGG + Intergenic
1014565749 6:122945671-122945693 ATGTTATAACAGTTGGAGTATGG - Intergenic
1014778881 6:125540789-125540811 ATGCCTTAACTGCTGGAGTACGG + Intergenic
1017717492 6:157222863-157222885 CTGCCCTCACAGCTGGGGTCTGG - Intergenic
1019888426 7:3925415-3925437 TTGCCCTAACAGCTTGAGCAGGG - Intronic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1023998875 7:45178095-45178117 CTCTCCTTACAGCTGGAGCTGGG + Intronic
1024890656 7:54197937-54197959 ATGTTCTAACAGGGGGAGTAGGG + Intergenic
1029687706 7:102160140-102160162 CTGTCATCCAAGCTGGAGTATGG - Intronic
1032017510 7:128389311-128389333 CTCTCCTCACATCTGGAGTCAGG - Intergenic
1032319133 7:130868737-130868759 CTGTTTTAACAGCTGTAGAATGG + Intergenic
1034520010 7:151612554-151612576 CTGTCCCATCAGCAGGCGTAGGG + Intronic
1035080560 7:156212542-156212564 CTCTCCTAACAGCTAGAATGTGG + Intergenic
1036450881 8:8866353-8866375 CTGTCCTCTAGGCTGGAGTACGG + Intronic
1037054310 8:14419274-14419296 ATGTCCTAACAGCTAGATAATGG + Intronic
1037579108 8:20234288-20234310 CTGTTCTAAAAGCTGGGGTTTGG - Intergenic
1038439659 8:27562549-27562571 CTTGCCTAACAGCTGGTGCAAGG - Intergenic
1038441410 8:27573184-27573206 CTGTGAGAACAGCTGGAGTGGGG + Intergenic
1039119043 8:34125365-34125387 CTGGCCAAACACCTGGAGAAAGG - Intergenic
1043204556 8:77420626-77420648 CATTCCTAGCAGCTGGAGGATGG + Intergenic
1046817145 8:118597232-118597254 CTGTCCTATCAGCTGCTGTTTGG + Intronic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1047078600 8:121434056-121434078 CTGAGGTAACAGATGGAGTAGGG + Intergenic
1047874661 8:129122785-129122807 CTGAGCTCACAGCTGGAGTGAGG + Intergenic
1049965341 9:774514-774536 CTGTCGTCCCAGCTGGAGTACGG + Intergenic
1052294135 9:26878776-26878798 CTGTCCCCCAAGCTGGAGTACGG - Intronic
1053359051 9:37470250-37470272 CTGTCATCCAAGCTGGAGTACGG + Intergenic
1056033991 9:82584506-82584528 CTTTCCTAACAGCCGGTTTATGG + Intergenic
1058565398 9:106279042-106279064 CTTTCCTAACAGTTGGTGTCAGG + Intergenic
1059130569 9:111744179-111744201 CTGTCATAACAGATGGATTAGGG + Intronic
1059779788 9:117514357-117514379 CTGGCCCAACAACTGGAGTTTGG + Intergenic
1060534875 9:124377252-124377274 CTGTCCTTACAGCAGGACTCTGG - Intronic
1061755530 9:132809562-132809584 CTGTCCCCACCACTGGAGTATGG + Intronic
1186023328 X:5281445-5281467 CTGTCATAAAGGCTGGAGTGCGG - Intergenic
1189840630 X:45072618-45072640 CTGCTCTAACTGCTGGAGCAGGG + Intronic
1194528745 X:95016095-95016117 CTGTCCCAACAGCTAGAGAGAGG - Intergenic
1195324496 X:103747304-103747326 CTTTACTAACAACTGGAGTGAGG + Intergenic
1195703165 X:107720133-107720155 TTTTCCTAAAAGCTGGAATAGGG - Intronic
1196776876 X:119346250-119346272 CTGTGCTAACTGCTGCTGTAAGG + Intergenic
1197356157 X:125439143-125439165 CTGTCCTAACAGCAGGAAAATGG - Intergenic
1199074726 X:143514374-143514396 ATTTTCTAAAAGCTGGAGTAGGG - Intronic
1200417998 Y:2933708-2933730 CTGTCATAAAGGCTGGAGTGTGG + Intergenic
1201337689 Y:12897932-12897954 ATGTTCTTACAGCTGAAGTAGGG + Intergenic
1201448507 Y:14084095-14084117 CTGACCTATCAGCTGGGGTTGGG + Intergenic