ID: 954869958

View in Genome Browser
Species Human (GRCh38)
Location 3:53760302-53760324
Sequence TATACTGTCGCAAAAGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954869953_954869958 19 Left 954869953 3:53760260-53760282 CCCTACTCCAGCTGTTAGGACAG 0: 1
1: 0
2: 2
3: 10
4: 129
Right 954869958 3:53760302-53760324 TATACTGTCGCAAAAGGCTGTGG 0: 1
1: 0
2: 0
3: 3
4: 56
954869954_954869958 18 Left 954869954 3:53760261-53760283 CCTACTCCAGCTGTTAGGACAGT 0: 1
1: 0
2: 0
3: 7
4: 102
Right 954869958 3:53760302-53760324 TATACTGTCGCAAAAGGCTGTGG 0: 1
1: 0
2: 0
3: 3
4: 56
954869955_954869958 12 Left 954869955 3:53760267-53760289 CCAGCTGTTAGGACAGTCAGTAC 0: 1
1: 0
2: 0
3: 8
4: 65
Right 954869958 3:53760302-53760324 TATACTGTCGCAAAAGGCTGTGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954869958 Original CRISPR TATACTGTCGCAAAAGGCTG TGG Intronic
908170285 1:61497536-61497558 TATACTCTCCCCACAGGCTGAGG - Intergenic
908573723 1:65437529-65437551 TAAAAGGTCACAAAAGGCTGAGG + Intronic
909832023 1:80203617-80203639 GATACTGTCTAAGAAGGCTGAGG + Intergenic
915958986 1:160248433-160248455 AAAACTGTCGCAACAGGCTGGGG + Intronic
923311015 1:232735463-232735485 TATTCTGTTGGAAAAGGTTGAGG - Intergenic
1063608095 10:7540610-7540632 TTTACTGTCGCAAATTGGTGAGG - Intergenic
1076484035 10:130804391-130804413 TATACGGTCGCAAAGGACTCAGG + Intergenic
1077895948 11:6453571-6453593 AGTACTATAGCAAAAGGCTGAGG + Intronic
1080555003 11:33407830-33407852 TAGACGGGCGCAGAAGGCTGGGG - Intergenic
1086208316 11:84286831-84286853 TTTACTGTTACCAAAGGCTGGGG + Intronic
1087046068 11:93844942-93844964 AATACTTTCCCACAAGGCTGAGG - Intronic
1090379951 11:126319437-126319459 GATACTGTGGCCAAATGCTGCGG - Intronic
1092754261 12:11748502-11748524 TATACCCTCTGAAAAGGCTGAGG - Intronic
1093387531 12:18576847-18576869 TATACTGTAGTCAAGGGCTGTGG + Intronic
1107386421 13:39914590-39914612 TATACTGTCTCCAGAGGCTCTGG - Intergenic
1114821199 14:26021191-26021213 TATACTATTGCATAAGGCAGCGG - Intergenic
1117219759 14:53591329-53591351 GATACTGTGGCAATAGGCAGAGG - Intergenic
1130925952 15:88386012-88386034 CATCCTGTTGCAAAAGGGTGAGG + Intergenic
1132445100 15:101909819-101909841 TATTTTGCCGCAAATGGCTGAGG + Intergenic
1138934707 16:61704997-61705019 TAAACAGCCTCAAAAGGCTGAGG + Intronic
1152365530 17:79854206-79854228 GATACTGTCCCAAAAGGCCAAGG - Intergenic
1158182055 18:54727739-54727761 TATGCTGTTGCTAAATGCTGTGG - Intronic
1159615749 18:70577701-70577723 TACACTTTCCCACAAGGCTGGGG + Intergenic
1160640210 19:123889-123911 TATTTTGCCGCAAATGGCTGAGG - Intergenic
935914196 2:107931539-107931561 TATACTTTCGTAGAAGGCTTTGG + Intergenic
937210912 2:120269884-120269906 TATTTTTTCCCAAAAGGCTGTGG + Intronic
938662136 2:133498255-133498277 CAAACTGCTGCAAAAGGCTGGGG + Intronic
941177129 2:162211543-162211565 TGTACTGTCATAAAAGGCAGGGG + Intronic
944312659 2:198251416-198251438 TTTACTCTCACAAAAGGCTAAGG + Intronic
947352439 2:229260578-229260600 TATACACTTGCAAAAGCCTGGGG + Intronic
1178045151 21:28685447-28685469 TAAACTTTAGCTAAAGGCTGTGG + Intergenic
954869958 3:53760302-53760324 TATACTGTCGCAAAAGGCTGTGG + Intronic
956963671 3:74433386-74433408 TAAAATCTCGCAAAAGGCTCAGG - Intronic
957179334 3:76856840-76856862 TATACTGTGGGGAGAGGCTGGGG + Intronic
959784803 3:110283137-110283159 TATTCTGTCTCAAAATTCTGTGG + Intergenic
963088453 3:141460142-141460164 AAAACTGTCACTAAAGGCTGGGG - Intergenic
964914278 3:161820391-161820413 TATACTGTTACAAATAGCTGTGG + Intergenic
970650749 4:18175134-18175156 TCTAATTTTGCAAAAGGCTGGGG + Intergenic
973076817 4:45939358-45939380 TATACTGTGGGCAAAGGCTGAGG - Intergenic
977791111 4:101104494-101104516 TATACTATGGCAAAGGCCTGGGG + Intronic
985422849 4:189801857-189801879 TATACTGTCTCACAGGTCTGAGG + Intergenic
987104980 5:14629849-14629871 TATACTGTCTCAAAAAGGGGGGG - Intergenic
991031522 5:62086923-62086945 TAAACTGTTACAAAAGGCTAAGG - Intergenic
1002747559 6:72296-72318 TATTTTGCCGCAAATGGCTGAGG - Intergenic
1003882904 6:10494506-10494528 TTTACTGACGCAAATGTCTGCGG - Intronic
1004584791 6:16989062-16989084 TATTCTGTGGCAAAAGGCTCTGG - Intergenic
1011533253 6:88348073-88348095 TTTACTCTCGCAAATGGATGTGG + Intergenic
1011707731 6:90019750-90019772 TCTACTCTCCCAGAAGGCTGTGG - Intronic
1013118055 6:107116944-107116966 TATACATTCGCAGAAGACTGAGG + Intergenic
1021427574 7:20519937-20519959 TATACTGTGACTAAAGGGTGTGG - Intergenic
1027458160 7:78419759-78419781 TATACTATCAGAAAGGGCTGTGG + Intronic
1029218497 7:98969712-98969734 TACACTGTCGCCTGAGGCTGCGG + Intronic
1036124848 8:6053163-6053185 TATGCTGACGTAAAAAGCTGAGG + Intergenic
1049777880 8:144414839-144414861 TGGACTGTCGGAACAGGCTGGGG - Exonic
1050677699 9:8075065-8075087 AATACTGTTGGAAAAGCCTGAGG - Intergenic
1059328365 9:113518526-113518548 CATAGTGTCCCAGAAGGCTGAGG - Intronic
1186980348 X:14951881-14951903 TATACTCTTGCAAAAGGCCTGGG - Intergenic
1187352430 X:18532807-18532829 TATAATGTCTCAAATGACTGAGG - Intronic
1188605867 X:32028596-32028618 CATTCTGTAGCAAAATGCTGTGG - Intronic
1190587029 X:51955670-51955692 TATAGAGTCTCAAAAGGCAGAGG - Intergenic