ID: 954869959

View in Genome Browser
Species Human (GRCh38)
Location 3:53760313-53760335
Sequence AAAAGGCTGTGGTTCTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 247}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954869953_954869959 30 Left 954869953 3:53760260-53760282 CCCTACTCCAGCTGTTAGGACAG 0: 1
1: 0
2: 2
3: 10
4: 129
Right 954869959 3:53760313-53760335 AAAAGGCTGTGGTTCTGCAGTGG 0: 1
1: 0
2: 3
3: 13
4: 247
954869955_954869959 23 Left 954869955 3:53760267-53760289 CCAGCTGTTAGGACAGTCAGTAC 0: 1
1: 0
2: 0
3: 8
4: 65
Right 954869959 3:53760313-53760335 AAAAGGCTGTGGTTCTGCAGTGG 0: 1
1: 0
2: 3
3: 13
4: 247
954869954_954869959 29 Left 954869954 3:53760261-53760283 CCTACTCCAGCTGTTAGGACAGT 0: 1
1: 0
2: 0
3: 7
4: 102
Right 954869959 3:53760313-53760335 AAAAGGCTGTGGTTCTGCAGTGG 0: 1
1: 0
2: 3
3: 13
4: 247
954869956_954869959 -2 Left 954869956 3:53760292-53760314 CCACATCTTCTATACTGTCGCAA 0: 1
1: 0
2: 1
3: 6
4: 76
Right 954869959 3:53760313-53760335 AAAAGGCTGTGGTTCTGCAGTGG 0: 1
1: 0
2: 3
3: 13
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954869959 Original CRISPR AAAAGGCTGTGGTTCTGCAG TGG Intronic
901287801 1:8095137-8095159 AAAAGGCTGTGAATCAGAAGGGG + Intergenic
901915545 1:12496827-12496849 CACAGGCTGGGATTCTGCAGAGG - Intronic
902091761 1:13909356-13909378 GAAAGGCTGTGTTTTTTCAGGGG + Intergenic
903575138 1:24335184-24335206 CAGAGGCTGTGGGTCTTCAGGGG - Intronic
904050828 1:27637282-27637304 AAGATGCTGAGGTTCTGCTGGGG - Intergenic
904826173 1:33275406-33275428 AGAATGCTGTGGTTATGGAGGGG - Intronic
905423850 1:37867659-37867681 AAAAGGATGTTGCTCTGAAGTGG + Intronic
905474912 1:38219278-38219300 AAAAGACTGTGGGGCTTCAGGGG + Intergenic
907806109 1:57821976-57821998 AAGAGGCTGAGGTTCAGCAAGGG + Intronic
908808953 1:67959617-67959639 AGAAGGCTGTGCTTTAGCAGTGG + Intergenic
908924224 1:69234061-69234083 AAAATGCTTTGGTTATGCATTGG + Intergenic
911721367 1:101194864-101194886 ATAAGGCAGTGATTCTTCAGTGG - Intergenic
911900502 1:103497381-103497403 AAAATGCTGTGGTTTTCCTGAGG - Intergenic
913384492 1:118244451-118244473 AAAAGGCTGTTTTGATGCAGGGG - Intergenic
914764415 1:150625512-150625534 AAATGACTGTGATTCTGCTGGGG - Intronic
914984246 1:152442534-152442556 AAGAGGGTGTGGGACTGCAGAGG - Intergenic
915458719 1:156056770-156056792 AAATGGCATTGGTTGTGCAGGGG - Intronic
917739928 1:177952316-177952338 AAACTGCTGTGGCTCTCCAGGGG - Intronic
919733319 1:200928488-200928510 GAGAGTCTGTGGTTCTGCAGGGG + Intergenic
919904482 1:202068684-202068706 AAAAGGAGGTGGTCCTGAAGGGG - Intergenic
920700383 1:208213797-208213819 AGAAGGGTGTGGTGCTGAAGGGG + Intronic
923425632 1:233866102-233866124 AGAATGCTGTGATTCTGCTGTGG + Intergenic
924161102 1:241232732-241232754 TTAAGACTGTCGTTCTGCAGTGG - Intronic
924606593 1:245540826-245540848 AAAGAGCGGTGGTTCGGCAGCGG - Exonic
1063117395 10:3081331-3081353 AAAGGACTGTGGTCCTGCAGGGG - Intronic
1063434126 10:6017082-6017104 AAAGGGCTGTGCTTCTCCTGTGG - Intronic
1064535062 10:16349918-16349940 CAGAGGCTGAAGTTCTGCAGAGG + Intergenic
1067591802 10:47519170-47519192 AAAAGGCTGTGGTACTGGCCAGG + Intronic
1069102596 10:64341695-64341717 AATAGGATTTGGTTCTGCATAGG - Intergenic
1071672082 10:87618298-87618320 AAAAGACTGAGGTTCCTCAGAGG + Intergenic
1072902249 10:99418841-99418863 AAAATCCAGTGTTTCTGCAGAGG - Intronic
1073278924 10:102337381-102337403 AAAAAACTATGGGTCTGCAGTGG + Intronic
1073813041 10:107172018-107172040 AAGGAGCTGTGGTTCTCCAGGGG + Intergenic
1074780490 10:116798633-116798655 CAAACGCTGTGGTTTTGCAGAGG - Intergenic
1075299372 10:121307732-121307754 AAAAGGCAATGGTTCTGGAATGG - Intergenic
1077541144 11:3147091-3147113 ACACGGCTGTGGTTCTGCCTTGG - Intronic
1078028947 11:7728777-7728799 ATAAGGGTGTGGTACTGCAGTGG - Intergenic
1078404425 11:11057530-11057552 AAATTGCTGTGGTTCTACACTGG + Intergenic
1078760765 11:14249492-14249514 ACTAGGCTGAAGTTCTGCAGGGG - Intronic
1080029826 11:27648666-27648688 AAAAGGCCGTGGTTGTGGGGAGG - Intergenic
1083073754 11:60015404-60015426 AAAAGACTTTTGTTCTGGAGTGG - Intergenic
1085662246 11:78379194-78379216 TTAAGACTGTGGTTCTCCAGAGG + Intronic
1087034714 11:93743657-93743679 GACAGGCTGTGGGTCTTCAGGGG - Intronic
1087239173 11:95756306-95756328 AGAAGCCTGTGGTGCAGCAGTGG + Intergenic
1087937597 11:104053111-104053133 AATAGACTGAGGTTCTTCAGAGG - Intronic
1088607628 11:111546599-111546621 AAGAGGCTCTGGTCCAGCAGTGG + Intronic
1088817038 11:113428486-113428508 TGAGGGCTGTGGTCCTGCAGGGG + Intronic
1089734238 11:120538746-120538768 AAAGGGCTGGGTTTCTGCATTGG + Intronic
1090270372 11:125381592-125381614 CCCTGGCTGTGGTTCTGCAGAGG + Intronic
1091249048 11:134126302-134126324 AAAAGGCTGTTGTTCAGAGGTGG + Intronic
1091306920 11:134542196-134542218 CACTGGCTGTGGGTCTGCAGAGG + Intergenic
1092012367 12:5125200-5125222 AAGGGGCTGTAGTGCTGCAGTGG + Intergenic
1092894256 12:12997877-12997899 GAAAGGCTGTGGTTCTGAGTAGG + Intronic
1093876313 12:24353369-24353391 AAAAGTGTGTAGTTCTACAGAGG - Intergenic
1095427158 12:42088642-42088664 AAAAGGCTGTGGTAGTAAAGTGG + Intronic
1095952887 12:47791160-47791182 AACAAGCAGAGGTTCTGCAGGGG + Intronic
1097958609 12:65511189-65511211 AAAAGGCCGTGGTTATGAGGAGG - Intergenic
1098533780 12:71572065-71572087 AAAAGGCTGATGTTTTGTAGGGG - Intronic
1100661309 12:96701938-96701960 AAGAGGCTGTGGGTGGGCAGGGG + Intronic
1104647947 12:130510279-130510301 GAAACACTGTGTTTCTGCAGTGG + Intronic
1104799390 12:131543566-131543588 AAAATGCTGTGGGGATGCAGAGG - Intergenic
1104835973 12:131791071-131791093 AAAAGGCAGTGATTGTGGAGTGG + Intronic
1105455702 13:20539404-20539426 AAAAGACTGTGGTTCAGAAAAGG + Intergenic
1105979776 13:25506658-25506680 ACACGGCTGTGGATCTGAAGAGG + Intronic
1106704128 13:32262381-32262403 AAAGGAATGAGGTTCTGCAGGGG - Exonic
1108425037 13:50290982-50291004 CAGTGGCTGTGTTTCTGCAGTGG + Intronic
1109067163 13:57711282-57711304 AAATGGCCATGGTTCTGCACAGG - Intronic
1109712632 13:66180421-66180443 AAGGGGCTGTAGTGCTGCAGCGG + Intergenic
1112184475 13:97114709-97114731 AGAAGGCTGAGTGTCTGCAGAGG - Intergenic
1112430029 13:99343039-99343061 AAGAGGCTGTGGTGCAGCAGAGG + Intronic
1116978634 14:51143461-51143483 TGAAGCCTGTGGTTCTGGAGTGG + Intergenic
1117531638 14:56665648-56665670 AGAAGGCGGTGGTTCAGGAGCGG - Intronic
1120098010 14:80410839-80410861 AAAAGCCAGTGTTTGTGCAGTGG - Intergenic
1120299854 14:82692577-82692599 AAATGACTGTGATTCTGCTGGGG - Intergenic
1125439672 15:39688683-39688705 ACAGGGCTGTGCTTCTGCATAGG - Intronic
1126336151 15:47588248-47588270 AAAAGGCAATGTCTCTGCAGAGG - Intronic
1127059808 15:55170783-55170805 AAAAGGGGGTGGTTCTCTAGGGG + Intergenic
1127352094 15:58163327-58163349 AAAAGTCTGTAGGCCTGCAGAGG + Intronic
1128388287 15:67165718-67165740 AATAGACTGGGGGTCTGCAGAGG + Intronic
1128415806 15:67444927-67444949 AAAAGCCTGGGATTCTGAAGGGG + Intronic
1129510486 15:76118107-76118129 AAAAGGCTGTGGATCTTCCCAGG - Intronic
1129515443 15:76154395-76154417 AGAAAGATGTGGTTCTGCAATGG + Intronic
1132506748 16:313911-313933 AAGATGCTGTGGTTGTGCTGAGG - Intronic
1132662488 16:1067848-1067870 AGATGGTTGTGGTTTTGCAGTGG + Intergenic
1133760723 16:8796508-8796530 CATGGGCTGTGGTGCTGCAGTGG - Exonic
1133886416 16:9832241-9832263 AAAAGGCTGAGGGGGTGCAGTGG - Intronic
1135853201 16:25983172-25983194 AAAAGGCTGGGCTTCTCTAGTGG - Intronic
1137671545 16:50282250-50282272 CAAGGGCTGTGGTTGTGCTGGGG + Intronic
1137942373 16:52701085-52701107 CAAAGTTTGTGGTTCTGAAGAGG + Intergenic
1139363738 16:66419808-66419830 AAAAGGCCATGGTTCAGGAGGGG - Intergenic
1141187976 16:81802007-81802029 AAAAATCTGTGGCTGTGCAGAGG + Intronic
1141563447 16:84885510-84885532 AGAAGGCCGTGGACCTGCAGGGG - Intronic
1141785264 16:86195462-86195484 AAATGGCTGTGGTTTTGGAGAGG - Intergenic
1143165748 17:4896544-4896566 TTAAGGATGTGGTGCTGCAGTGG + Exonic
1145745195 17:27313450-27313472 AAAAAACTCTGTTTCTGCAGGGG + Exonic
1145756695 17:27397098-27397120 GAAAGCCTGTGGTTATACAGTGG - Intergenic
1146107914 17:30059385-30059407 AAAATGCAGTGATTCAGCAGTGG - Intronic
1146525278 17:33562236-33562258 AAATGGCTGTTTTTATGCAGGGG + Intronic
1147370417 17:39988882-39988904 ACACAGCTGTGGATCTGCAGAGG + Intronic
1147414872 17:40281450-40281472 AAAATGATGGGGCTCTGCAGTGG - Exonic
1149401059 17:56296391-56296413 AAAAGGCTGTGGGTCAGGCGAGG + Intronic
1149775419 17:59353298-59353320 TAAAGGCCGTGGTTTGGCAGCGG - Exonic
1151113141 17:71703151-71703173 AAAAGGATGTGTGTTTGCAGAGG - Intergenic
1154086814 18:11313685-11313707 ACAAAGTTGTGCTTCTGCAGAGG + Intergenic
1155227231 18:23739143-23739165 AAGAGGCTGTGCATCTGCAGAGG - Intronic
1158389505 18:57033704-57033726 AGAATGCTTCGGTTCTGCAGTGG - Exonic
1158973388 18:62688785-62688807 AACAGGCTGTGACTCTGCTGTGG - Intergenic
1159022246 18:63153265-63153287 AAAAGGCTGTAGTTGTCGAGTGG + Intronic
1161303661 19:3555636-3555658 AAGAGGCAGTGGATCTCCAGTGG - Intronic
1161499740 19:4607288-4607310 AGGAGGCTGTGGCTCTGCCGTGG + Intergenic
1164780665 19:30889147-30889169 AAAGGGCAGTGGGTCTGCATAGG + Intergenic
1164911146 19:32012960-32012982 AAAAGCCTGTGGTATTGCTGGGG - Intergenic
1165064596 19:33221598-33221620 GAGGGGCTGGGGTTCTGCAGAGG + Intronic
1167024415 19:46904804-46904826 AGAAGCCTGTGGTTCCTCAGAGG + Intergenic
1167042767 19:47032404-47032426 AAGAGGCTGCTGTTCTCCAGAGG - Intronic
926219326 2:10924662-10924684 AGATGGCTGTGGTGCTGCCGAGG + Intergenic
927543132 2:23929732-23929754 AAAAGGCTAGTGTCCTGCAGAGG + Intronic
929607438 2:43244381-43244403 AAAAAGACGTGGTTCTCCAGGGG + Intronic
930912013 2:56640518-56640540 ATAAGGCTGTTGCTATGCAGTGG - Intergenic
932526421 2:72475069-72475091 ATGAGGCTGTGGTTTTGCTGGGG + Intronic
932863593 2:75318987-75319009 TAAAGGCTGTGGGTCTGCATGGG - Intergenic
934521910 2:95025216-95025238 CACAGGCTGGGGGTCTGCAGTGG - Intergenic
934589302 2:95531804-95531826 CAAAGGCTGTGATGCTGCTGTGG + Intergenic
935181111 2:100691981-100692003 AAGGGGCTGTGGGTCTGGAGAGG - Intergenic
935673420 2:105574362-105574384 AAAGAGCTGTGGCTCTGCAAGGG + Intergenic
938082192 2:128376222-128376244 TAGAGGCTGTGGTTCTTGAGAGG + Intergenic
938480643 2:131658830-131658852 GAGAGGCGGGGGTTCTGCAGTGG + Intergenic
939152544 2:138490170-138490192 TAAAGCCTGGGGGTCTGCAGAGG - Intergenic
940808187 2:158211265-158211287 AAAAGTCTGTGTTACTGAAGAGG + Intronic
942180920 2:173379811-173379833 ATAGGGCTGGGGTTCTGGAGAGG - Intergenic
942596796 2:177599249-177599271 AAAAGCCTGTTTTTCTGCAAAGG - Intergenic
942857313 2:180564606-180564628 ATAAGGCTGTGGCTCAGGAGAGG + Intergenic
943446821 2:187996297-187996319 AAAACTCTGTGTGTCTGCAGTGG - Intergenic
943527450 2:189034988-189035010 AAAAAGCTGTGGTTCTCAAAGGG - Exonic
945976605 2:216276003-216276025 AGATGGCTTTGGTTCTGCTGAGG - Intronic
948028630 2:234798775-234798797 ATAAGGCTCTGGTTCTCCACTGG + Intergenic
948338416 2:237229820-237229842 AAATGGCAGTGATTCTGGAGAGG - Intergenic
1169331563 20:4720701-4720723 AAAAGTCTGTGGTTCTAGAAAGG + Intergenic
1171187380 20:23132512-23132534 GAAAGGCTCGTGTTCTGCAGTGG + Intergenic
1171354094 20:24530467-24530489 AAAAGCCTGTGATTTGGCAGTGG - Intronic
1172319080 20:33982306-33982328 GGAAGGCTGTGATTCTGGAGTGG - Intergenic
1172410174 20:34715539-34715561 AAGAGGGTGTGGTCCTGCATTGG + Intronic
1172658573 20:36551026-36551048 AAATGCCTTTGGTGCTGCAGTGG - Exonic
1172838254 20:37886700-37886722 ATAGGCCTGTGGATCTGCAGGGG + Intergenic
1173643453 20:44619151-44619173 AAGATGCTGGCGTTCTGCAGAGG + Intronic
1174241479 20:49138894-49138916 TAAAGGCTGGAGTTCTACAGAGG + Intronic
1175223805 20:57433295-57433317 ACATGGCTGTGGAGCTGCAGAGG - Intergenic
1175257342 20:57655343-57655365 CAAAGGCTGTGGTGCAGGAGGGG - Intronic
1176889905 21:14303064-14303086 AAAAGGCTGAGGTTCCTCAGTGG - Intergenic
1178365394 21:31985640-31985662 AGAAGGCAGTGATGCTGCAGTGG + Intronic
1179481537 21:41681747-41681769 GAAAGGCTGTGCTTCTGCAGGGG - Intergenic
1179992706 21:44956947-44956969 GGAAGGCTGTGGTTCTGGCGAGG + Intronic
1180260126 21:46662787-46662809 AAAACGCTATGATTCTGCACTGG - Intronic
1181754699 22:25015487-25015509 AAAAGGCGGAGGTTAAGCAGAGG + Intronic
1181956907 22:26594061-26594083 AGAAGGCAGTGGCTCGGCAGTGG + Intronic
1182149683 22:28019345-28019367 GAAGGGCTGAGGTTCAGCAGAGG - Intronic
1182458612 22:30468843-30468865 AGAAAGCTGAGGTCCTGCAGGGG + Intronic
1182871260 22:33649908-33649930 ACAAGTCTGTGGTTCTGAATTGG + Intronic
1184251375 22:43262330-43262352 AAAAGAGTATGGTTCTGAAGTGG - Intronic
1184581436 22:45420499-45420521 AAAAGGCTTTGTTTCAGCTGTGG + Intronic
1184815328 22:46864637-46864659 AAAAGGCTGTGTTTCTTCTCAGG - Intronic
1184890360 22:47375400-47375422 AAAAGTCTGAAGTCCTGCAGAGG - Intergenic
949779785 3:7672949-7672971 AACAGGCTGTTGTTTTTCAGTGG + Intronic
950712609 3:14823510-14823532 AAAACTCTGTGATTCTACAGAGG - Intronic
952345180 3:32477101-32477123 AAAAGGCTGTGGCCCAGCAAAGG + Intronic
953272336 3:41457804-41457826 AAAAGGGAGTGGTTCTGGAAAGG - Intronic
953280102 3:41546830-41546852 ATAAGGCTGTGGTCCTTGAGTGG - Intronic
954241533 3:49297632-49297654 AAAAGGCTGTGGCTGTGCTGAGG + Intronic
954869959 3:53760313-53760335 AAAAGGCTGTGGTTCTGCAGTGG + Intronic
955766885 3:62354242-62354264 AAGAAACTGTGGGTCTGCAGAGG + Intergenic
955870124 3:63429361-63429383 CAATGGCTGTGGATCTGAAGTGG + Intronic
957711047 3:83859929-83859951 ACAAGGCTCTGCCTCTGCAGCGG + Intergenic
959007981 3:101042224-101042246 AAAAGGCTGGGCTTCTGAAATGG - Intergenic
960224491 3:115153882-115153904 AAATGGCTGTTGTTTTGGAGTGG - Intergenic
960297189 3:115958768-115958790 TAAAGGCTGTTTTTCTGCACAGG + Intronic
961505577 3:127368761-127368783 AGAAGGCAGTGGGCCTGCAGGGG + Intergenic
961863525 3:129937165-129937187 AAAAGGCTGGGGGTTTGCAAAGG + Intergenic
962241486 3:133754486-133754508 GAAAGTCTGTGGATCTGCAAAGG - Exonic
962929949 3:140026942-140026964 GTAAGGCTATGGATCTGCAGAGG - Intronic
963315542 3:143754613-143754635 AAAAGGCTGTGTTGCTGAAAAGG + Intronic
968597621 4:1493465-1493487 GAAAGGCCGAGGCTCTGCAGCGG + Intergenic
968673895 4:1866691-1866713 CAAAGGCTGTGCCTCTGCTGTGG + Intergenic
969910591 4:10441709-10441731 AAGAGGCTGTGCTTGTGCAGGGG + Exonic
970970072 4:21972418-21972440 AAAAGGCTGTGGATCAACTGAGG - Intergenic
972008748 4:34147666-34147688 AACAGGAGGTGGTTCTGCATAGG - Intergenic
972717546 4:41662812-41662834 AAAATGCTGTGGTTCTGCAATGG - Exonic
972877923 4:43388196-43388218 AACAGGTTGTGGTGCTTCAGAGG - Intergenic
976421952 4:84854927-84854949 AAAAATTTCTGGTTCTGCAGAGG + Intronic
978203378 4:106049516-106049538 AAAAGGCTGTGAATGTGCTGGGG + Intronic
987174317 5:15291875-15291897 AAATGTTTGTGGTTCTGCAATGG + Intergenic
987541932 5:19267060-19267082 AAATGGATGTGGCTCTGTAGAGG + Intergenic
988276154 5:29083262-29083284 AAAGGGCTGTTGGTGTGCAGGGG + Intergenic
988575337 5:32417673-32417695 AGAAGGCTGAGGTTGGGCAGCGG + Exonic
992620955 5:78592319-78592341 AATTTGCTGTGGATCTGCAGAGG - Intronic
998894428 5:146783861-146783883 AGAAGGCTGTGCTTCTGCCTCGG + Intronic
1001112167 5:168905735-168905757 GAAACGCTGTGGTTCAGCAAGGG - Intronic
1001988336 5:176094848-176094870 ACTCGGCTGTGGTACTGCAGAGG + Intronic
1002228532 5:177743286-177743308 ACTCGGCTGTGGTACTGCAGAGG - Intronic
1003488091 6:6596909-6596931 AAGAGTCTGTAGTTCTGAAGAGG + Intronic
1004790084 6:19015947-19015969 AAAAGTCAGTGGTGCTGCTGGGG + Intergenic
1005468680 6:26140688-26140710 AAGAGGCTGGGGTTCTGAATTGG + Intergenic
1006230464 6:32581778-32581800 AGGAGGTTGTGGTGCTGCAGGGG + Exonic
1006886278 6:37384747-37384769 AAAAGGCTGTCTTTCAGCAAAGG - Intronic
1008523420 6:52383990-52384012 AACAGGGTATGGGTCTGCAGGGG + Intronic
1011001798 6:82598113-82598135 TAATGGCTGTGAGTCTGCAGGGG - Intergenic
1011775130 6:90721687-90721709 AAAATGCTGTGACTCTGAAGGGG + Intergenic
1011794556 6:90938281-90938303 AAATGGTTGTGGTTTTTCAGTGG + Intergenic
1011858127 6:91720612-91720634 AAAAGGGAGTGATACTGCAGGGG - Intergenic
1012033396 6:94101336-94101358 AAAAGGCTGTGTATCAGAAGTGG - Intergenic
1012796245 6:103765770-103765792 AAATGGCTCTGGTTATCCAGGGG + Intergenic
1014085623 6:117339589-117339611 AAAAGTCTGTGGTTCTGCAAGGG - Intronic
1016842500 6:148538441-148538463 AAGAGCCTGTGGCTTTGCAGTGG - Intronic
1017172791 6:151473480-151473502 AGAAAGCTGAGGTTCTGCAATGG + Intergenic
1017428791 6:154349924-154349946 AAAAGAATGTTGTTCTGCTGGGG + Intronic
1018885147 6:167928873-167928895 AGAAGGCTGTGTTTCTTCTGAGG - Intronic
1022450707 7:30512062-30512084 CAAAGGCTGTGTGTCTGCTGAGG + Intronic
1023771296 7:43558949-43558971 ACAAGGCTGTAGTTAGGCAGTGG + Intronic
1024874539 7:54006890-54006912 AGAAGGCTGAAGTTTTGCAGGGG + Intergenic
1028894601 7:96027051-96027073 ATACGACTGTGTTTCTGCAGAGG + Intronic
1028927577 7:96376047-96376069 AAAAGCATGTAGTTCTGCAAAGG + Intergenic
1029510737 7:100993329-100993351 ATAAGGCTGTGGTACTGCCAGGG - Exonic
1029511230 7:100996578-100996600 ATAAGGCTGTGGTACTGCCAGGG - Exonic
1029511456 7:100998000-100998022 ATAAGGCTGTGGTACTGCCAGGG - Exonic
1029511954 7:101001249-101001271 ATAAGGCTGTGGTACTGCCAGGG - Exonic
1031159255 7:118146190-118146212 AAAACACTCTGCTTCTGCAGTGG + Intergenic
1031967991 7:128041953-128041975 AAATGGCTCTGGTTCTGATGGGG + Intronic
1032280262 7:130494105-130494127 ACAAGCCTGTGGTTTTACAGTGG - Intronic
1032485729 7:132286112-132286134 AAAAGAGTGTGGTCCTGCTGTGG - Intronic
1032524421 7:132568938-132568960 CAAAGGCTGGGCTCCTGCAGGGG + Intronic
1033607962 7:142941317-142941339 CAAAGGCTGGGGTGCTGCTGAGG + Exonic
1033649248 7:143328307-143328329 CAAAGGCTGGGGTTGGGCAGAGG + Intronic
1034987247 7:155523904-155523926 GAAAGGCTGTGGCACTACAGAGG + Intronic
1035593558 8:836534-836556 ACAAGGCTGAGGTTCTGCCGGGG + Intergenic
1035930797 8:3777772-3777794 AGGAGGCTGTGGGTCTGGAGTGG - Intronic
1037499228 8:19469590-19469612 AAAGGGCAGAGGTTCTGAAGTGG - Intronic
1037847007 8:22292353-22292375 AAGAGGCTGTGGTAATCCAGTGG + Intronic
1038262295 8:26006788-26006810 AAATTGCAGTGGTTCTGAAGAGG - Intronic
1038730826 8:30126179-30126201 AACAGGCTGTGGATCAGCACTGG + Intronic
1039187383 8:34932354-34932376 AAAATGCTGTGGTTCAGTATGGG - Intergenic
1044598301 8:93979666-93979688 AAAAGGCATTGGTTCTTCATGGG + Intergenic
1045834250 8:106501663-106501685 GAAAGGATTTTGTTCTGCAGAGG - Intronic
1047035919 8:120938333-120938355 AAAAGGCTGTGATACGGCAATGG - Intergenic
1048368981 8:133760655-133760677 ATAAGGCTGTGGTTCAACACAGG - Intergenic
1048914949 8:139173631-139173653 AACTGTCTGTGGTTCTGAAGGGG - Intergenic
1051327268 9:15986377-15986399 GAAAGGCTGTCTTGCTGCAGAGG + Intronic
1051802813 9:20955714-20955736 AAAAGTCAGAGGTTCTTCAGGGG - Intronic
1054784102 9:69194156-69194178 AAAAGGCTGTGGGAGCGCAGAGG - Intronic
1056404035 9:86257373-86257395 AAAGGCCTGCTGTTCTGCAGGGG - Intronic
1056768408 9:89459591-89459613 AAGAGGCTCTGGGTCTGCAGGGG - Intronic
1057360758 9:94371996-94372018 AATAGGCTGTGATTCTACTGAGG - Intergenic
1057662584 9:97016132-97016154 AATAGGCTGTGATTCTACTGAGG + Intergenic
1059496208 9:114711354-114711376 AAAACTCTGGGGTACTGCAGGGG + Intergenic
1060533869 9:124367270-124367292 TAAAGGCTGTGTTTGTTCAGAGG - Intronic
1060973619 9:127752905-127752927 AAAAGGTGGTGTTTCTGCTGAGG + Intronic
1062724610 9:138064775-138064797 AGAAGGCTCTGGAGCTGCAGAGG - Intronic
1186305184 X:8248814-8248836 AAAAGGCGGTGCATTTGCAGTGG - Intergenic
1186359398 X:8823907-8823929 GAAGACCTGTGGTTCTGCAGGGG + Intergenic
1193706962 X:84833022-84833044 ACAAGGCTGTGGTTCAGCTAAGG + Intergenic
1195701371 X:107708209-107708231 AAAAGGCTGTAGCTTTGCATAGG - Intergenic
1195936985 X:110134801-110134823 AACAGGCTGTGATTCTCCAAAGG + Intronic
1196590541 X:117481792-117481814 AAAAGGGTGTGGTTCTTCCCCGG + Intergenic
1199089953 X:143680130-143680152 GAAATGCTGTGGATGTGCAGAGG + Intergenic
1201851998 Y:18495144-18495166 AAAAAGCTTTCTTTCTGCAGAGG - Intergenic
1201881323 Y:18825236-18825258 AAAAAGCTTTCTTTCTGCAGAGG + Intronic