ID: 954870060

View in Genome Browser
Species Human (GRCh38)
Location 3:53761075-53761097
Sequence GAAGTTGAACAGATGGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954870057_954870060 -9 Left 954870057 3:53761061-53761083 CCTTGAAGAAGGGTGAAGTTGAA 0: 1
1: 0
2: 0
3: 25
4: 265
Right 954870060 3:53761075-53761097 GAAGTTGAACAGATGGAGTTGGG 0: 1
1: 0
2: 2
3: 15
4: 248
954870054_954870060 13 Left 954870054 3:53761039-53761061 CCATCAGGGAACATTTATCTGAC 0: 1
1: 0
2: 1
3: 15
4: 143
Right 954870060 3:53761075-53761097 GAAGTTGAACAGATGGAGTTGGG 0: 1
1: 0
2: 2
3: 15
4: 248
954870051_954870060 30 Left 954870051 3:53761022-53761044 CCGGGACTGCGAAGGTTCCATCA 0: 1
1: 0
2: 0
3: 2
4: 80
Right 954870060 3:53761075-53761097 GAAGTTGAACAGATGGAGTTGGG 0: 1
1: 0
2: 2
3: 15
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954870060 Original CRISPR GAAGTTGAACAGATGGAGTT GGG Intronic
902190141 1:14756684-14756706 GGAGTTGAAGAGATGAAGTTAGG - Intronic
903000108 1:20259185-20259207 GAAGGAGAAGAGATGGAGGTTGG + Intergenic
905409480 1:37758401-37758423 GAAGTTGAAGAGCTTGAGTCAGG - Intronic
906257721 1:44363210-44363232 GGAGTTCAACAGGTGGAGATAGG - Intergenic
906482773 1:46210724-46210746 GTAGCTGAACAGATGGAGGGTGG - Intronic
911658273 1:100469578-100469600 GAAGTTGAAGAAATGGTCTTAGG + Intronic
913052341 1:115128846-115128868 GCAGTTAAACACATGGAATTTGG - Intergenic
913566423 1:120077259-120077281 GGAGTTGATCAGATGGACCTGGG - Intergenic
913631708 1:120716290-120716312 GGAGTTGATCAGATGGACCTGGG + Intergenic
914287182 1:146237975-146237997 GGAGTTGATCAGATGGACCTGGG - Intergenic
914548214 1:148688717-148688739 GGAGTTGATCAGATGGACCTGGG - Intergenic
914618469 1:149382989-149383011 GGAGTTGATCAGATGGACCTGGG + Intergenic
915097392 1:153473038-153473060 GTAGTTGAACATATGGGGGTGGG - Intergenic
915342360 1:155183677-155183699 GAGGTTGAAGGGATGGATTTTGG - Intronic
917557459 1:176105146-176105168 GGAGTAGAAAAGATGGAGGTAGG + Intronic
917941917 1:179930963-179930985 TAAGTTGAACAGGAGAAGTTTGG + Intergenic
919334476 1:196214440-196214462 GAAGCAGGAAAGATGGAGTTTGG + Intergenic
920212161 1:204336034-204336056 GAAGAAGACCAGATGGAATTAGG - Intronic
920251737 1:204626473-204626495 GGAGTTGAATAGTTGAAGTTGGG - Intronic
922396348 1:225205182-225205204 GAATTTCAACACATGGATTTTGG - Intronic
923722335 1:236477642-236477664 GAAGTGCAACAGAGGAAGTTCGG + Intronic
923800820 1:237206406-237206428 GAAGTTGGATAGATAGCGTTAGG + Intronic
924315041 1:242786656-242786678 GCAGTTGAAAACATGGAGTGTGG - Intergenic
1066957444 10:42186371-42186393 GAAGTAAAACACATGCAGTTAGG - Intergenic
1067485701 10:46647936-46647958 GAATCAGAACAGAGGGAGTTAGG + Intergenic
1067609057 10:47693715-47693737 GAATCAGAACAGAGGGAGTTAGG - Intergenic
1068067420 10:52149411-52149433 GAACTTCAACATATGGATTTGGG - Intronic
1068875647 10:61993170-61993192 GATGTTGAAGAGTTGGAGTCAGG - Intronic
1069191197 10:65493228-65493250 GAAGTTCAAAACATGGAATTTGG + Intergenic
1071624644 10:87155360-87155382 GAATCAGAACAGAGGGAGTTAGG - Intronic
1073621864 10:105058421-105058443 GAAATAGAACAAATGGAGTTGGG + Intronic
1076338647 10:129727884-129727906 GGATTTGAACACATGGAGTAAGG + Intronic
1077609372 11:3635079-3635101 GAAGTAGAACAGATACAGCTTGG - Intergenic
1079897676 11:26142482-26142504 AAAGATGAACAGATGGAATGAGG + Intergenic
1084194765 11:67518207-67518229 GAAGATGCTGAGATGGAGTTAGG + Intergenic
1084360607 11:68666575-68666597 GCAGGAGAACCGATGGAGTTGGG + Intergenic
1087915271 11:103802899-103802921 GAATTTGAAGAGATAGAGTTGGG - Intergenic
1088045632 11:105447971-105447993 GAAGATGAACATATAGACTTGGG + Intergenic
1088160010 11:106857416-106857438 GAATTTCAACATATGGATTTTGG + Intronic
1088693969 11:112350422-112350444 GGAGTCGGACAGGTGGAGTTAGG + Intergenic
1089834609 11:121359016-121359038 AAAGTTGTACAGCTGGAGGTAGG + Intergenic
1089908787 11:122074453-122074475 AAACTTGGACAGATGGAGATGGG - Intergenic
1090119496 11:124009943-124009965 GAAGTAGAAGAAATAGAGTTGGG - Intergenic
1090767174 11:129886048-129886070 GAAGATAAACAGATGGATTTTGG - Intronic
1091804056 12:3343381-3343403 GAAGGTGAACTGATGCATTTTGG + Intergenic
1098291771 12:68963290-68963312 TAACTTTAACAGATGGAGTGAGG - Intronic
1101366064 12:104071697-104071719 GAAGTTAAACAGGTTGAGGTGGG - Intronic
1102846884 12:116194540-116194562 GAATTTGATCAGATGGATTGAGG - Intronic
1103425140 12:120827446-120827468 GAAGTTGAAAAGATGAAATGAGG - Intronic
1104404361 12:128505326-128505348 GAAGTTGAGCAGAGGGATGTAGG - Intronic
1105623701 13:22093043-22093065 GAGGCTGACCAGATGGAGTCAGG - Intergenic
1106128987 13:26923885-26923907 GAAGTTAAACAGATGCAGAAAGG - Intergenic
1106905943 13:34408873-34408895 GCAGTTGGTAAGATGGAGTTGGG - Intergenic
1107972953 13:45661600-45661622 GAAGTTAAGCACATGGAGTCTGG + Intergenic
1108107476 13:47027271-47027293 GAATTAAAACAGATGAAGTTGGG + Intergenic
1112129073 13:96501410-96501432 GAATTTGAACACAGGGAGCTTGG - Intronic
1115363713 14:32532964-32532986 AAAGTTGAACAAATAGAGGTTGG + Intronic
1117563081 14:56964935-56964957 AGAGTTGAAAAAATGGAGTTGGG - Intergenic
1118418117 14:65566428-65566450 GAAGTTGAATAGATTGGATTAGG + Intronic
1118656488 14:67955856-67955878 GAATTTGGACAGATGAAGATGGG + Intronic
1119766036 14:77188112-77188134 GAAGATGAACAGATGAGGATAGG - Intronic
1120389431 14:83887274-83887296 AAAGTTGAACACATGGACTATGG - Intergenic
1120894138 14:89514736-89514758 CAAGATGCACAGATGGAGTGAGG - Intronic
1125741075 15:41965396-41965418 AAATGTGAACAGATGGGGTTTGG + Intronic
1126012629 15:44317679-44317701 GCAGTTGGACATATGGAGCTCGG - Intronic
1126584271 15:50267334-50267356 GAATCTGAACAGATTGAATTGGG - Intergenic
1127415530 15:58753634-58753656 GAAGTTAAATATATTGAGTTTGG - Intergenic
1127519970 15:59734133-59734155 GATGAAGAACAGATGGAATTGGG + Intergenic
1128150725 15:65362099-65362121 GAAGTGGTACAGAGGGAGCTGGG + Intronic
1128320507 15:66690508-66690530 GCAGCAGAACAGAGGGAGTTGGG - Intergenic
1129950497 15:79584847-79584869 TAAACTGAACAGATGTAGTTTGG - Intergenic
1132176752 15:99721933-99721955 CAAGTAGAGGAGATGGAGTTTGG + Intronic
1133448567 16:5884421-5884443 GCGGTGGAACAGATGGATTTTGG - Intergenic
1136484957 16:30565731-30565753 GAAGATTAACAGATGGGCTTAGG - Intergenic
1137401683 16:48158629-48158651 TACTTTGAACTGATGGAGTTTGG - Intergenic
1138650644 16:58459062-58459084 GAAGATCAGCAGATGGAGATGGG - Intergenic
1140418534 16:74796178-74796200 TCAGTTGAAGAGATGGAGCTGGG + Intergenic
1141157884 16:81609805-81609827 GGAGATGGAGAGATGGAGTTTGG + Intronic
1141743660 16:85911605-85911627 GAAGTTACAGAGATGGAGTGCGG + Exonic
1143577378 17:7802134-7802156 GAAGTTGGGAAGAGGGAGTTGGG + Intronic
1146949015 17:36892838-36892860 GAAAATGAAGAGTTGGAGTTTGG - Intergenic
1147958083 17:44148761-44148783 GGAGTAGAACAGCTTGAGTTGGG - Exonic
1149388133 17:56162619-56162641 GAAATTCAACATATGGATTTGGG + Intronic
1150856931 17:68762006-68762028 GACAGTGAACAGTTGGAGTTAGG - Intergenic
1151878631 17:76881445-76881467 GATGGGGAAGAGATGGAGTTAGG + Intronic
1152666658 17:81574324-81574346 GGAGTGGAAAAGATGCAGTTGGG - Intronic
1153265527 18:3265127-3265149 AAAGTTGAAAAAATTGAGTTTGG + Intronic
1153893376 18:9538441-9538463 GAGGCTGAACACATGGAATTGGG - Intergenic
1156959555 18:43007907-43007929 AAAGTAGAAAAGATAGAGTTGGG + Intronic
1159263790 18:66052078-66052100 GGAGATGAAGAGATAGAGTTGGG - Intergenic
1159749522 18:72283191-72283213 TAAATGGAAGAGATGGAGTTGGG + Intergenic
1159788961 18:72752135-72752157 GAAGTTTAACAGAACGAGCTAGG + Intronic
1160313123 18:77816232-77816254 GGACTTGAACATATGGATTTTGG + Intergenic
1163138556 19:15331662-15331684 GAAGGTGAAGAGATGGGGGTGGG + Intronic
1164144411 19:22502844-22502866 GAACTCAAACAGATGGAGATTGG - Intronic
1164463721 19:28470114-28470136 GAGGCAGAACAGATGGAGATGGG + Intergenic
1164867438 19:31616451-31616473 CAAGATGAAAATATGGAGTTCGG + Intergenic
1165604948 19:37093817-37093839 GAGGTAGAACAGATGGAGAATGG + Intronic
1167703869 19:51066654-51066676 GACGTGGACCAGATGAAGTTTGG + Intergenic
925072609 2:983064-983086 GAAGTTGCAGAGGTGGAGGTTGG + Intronic
925072633 2:983245-983267 GAAGTTGCAGAGGTGGAGGTTGG + Intronic
925072649 2:983351-983373 GAAGTTGCAGAGGTGGAGGTCGG + Intronic
927427336 2:22995752-22995774 GAAGTTTAAAACATGGAGATAGG - Intergenic
928345666 2:30492523-30492545 GAATTTTAACAGTAGGAGTTTGG + Intronic
928825971 2:35421378-35421400 GAAGTTCAACATATGAATTTTGG + Intergenic
929058690 2:37901228-37901250 GAATTTCAACAAATGAAGTTAGG + Intergenic
929438861 2:41949785-41949807 GAGGGAGAAGAGATGGAGTTTGG - Intronic
929484615 2:42342467-42342489 AAAGTAAAGCAGATGGAGTTAGG - Intronic
929839558 2:45443550-45443572 GCAGGTGGACATATGGAGTTTGG + Intronic
930168185 2:48223911-48223933 GGAGTGGAACAGTTGTAGTTGGG - Intergenic
930952469 2:57159806-57159828 GAGGATGAAAAGTTGGAGTTGGG - Intergenic
931115899 2:59166468-59166490 GAACTTCAACATATGGATTTGGG - Intergenic
933323989 2:80812796-80812818 AAAGTTGATCACATGGAGGTAGG + Intergenic
934049284 2:88197001-88197023 GAACTTGAACATATGAATTTTGG - Intergenic
934305553 2:91818829-91818851 GAAGTAAAACACATGCAGTTAGG - Intergenic
934327703 2:92033919-92033941 GAAGTAAAACACATGCAGTTAGG + Intergenic
934466089 2:94264449-94264471 GAAGTAAAACACATGCAGTTAGG + Intergenic
934904232 2:98185063-98185085 GGAGTGGTAGAGATGGAGTTGGG - Intronic
935600631 2:104918372-104918394 GAACTTGAACATATGAATTTTGG - Intergenic
935978871 2:108607003-108607025 GAAGTTCAACATATGAATTTTGG - Intronic
937761355 2:125607064-125607086 GAAGTTGAGTGTATGGAGTTTGG - Intergenic
939023730 2:136987534-136987556 GAAGTGGAAAACATGGAGTTAGG + Intronic
942888837 2:180962768-180962790 GAATTTCAACATATGAAGTTTGG + Intergenic
945523872 2:210864332-210864354 TAAGTTGAACATATTGAGATGGG + Intergenic
949020784 2:241740164-241740186 GTAGGTGGACAGATGGATTTAGG + Intronic
1168974985 20:1958078-1958100 TGAGTTGAAGAGATGGAGCTGGG + Intergenic
1169871838 20:10256003-10256025 GAAGTAGAACAGATGGATTTAGG + Intronic
1169994045 20:11536602-11536624 GAATTTGAAGAGAAGGAATTAGG - Intergenic
1170918458 20:20652294-20652316 AAAGATGAACAGGTGCAGTTTGG - Intronic
1173566318 20:44040959-44040981 GGAGCTGAACTGATGGAGGTGGG + Intronic
1177895103 21:26847289-26847311 GAAGTCGAAGAGAAGGAGGTAGG - Intergenic
1178250948 21:31002962-31002984 GAAGTTCAAGAGATAGAGGTGGG - Intergenic
1179014624 21:37585225-37585247 AAAGTTGAACAGAAGCAGTCAGG + Intergenic
1179282339 21:39944707-39944729 GAAGTTGAACAGGTGGAGATAGG + Intergenic
1180587217 22:16903616-16903638 GAAGTAAAACACATGCAGTTAGG + Intergenic
1181163309 22:20970191-20970213 GAAGCTCAATAGATGGAGTTGGG - Intronic
1181331486 22:22095746-22095768 GACCTTGATCAGATGCAGTTTGG - Intergenic
1181566309 22:23740799-23740821 GAATTTGAACAGAGGGAATGAGG + Intergenic
1181870904 22:25898543-25898565 GGAGTTGAAGTGAGGGAGTTAGG - Intronic
1182371179 22:29812201-29812223 GCAGCTGAATGGATGGAGTTGGG + Intronic
1185035208 22:48472027-48472049 GAAGAGGAACAGTTGGAGCTGGG + Intergenic
951090977 3:18573638-18573660 GCAGAAGAACAGATGCAGTTGGG - Intergenic
954287493 3:49629417-49629439 GAAGATGAGAAGATGCAGTTGGG + Intronic
954870060 3:53761075-53761097 GAAGTTGAACAGATGGAGTTGGG + Intronic
956352913 3:68357803-68357825 GAACTTGAACAGGTGTAATTGGG - Intronic
956408750 3:68956440-68956462 GAAATTGAACAGATTCATTTTGG - Intergenic
956466790 3:69527505-69527527 TAAGTTGAACAGAATGACTTTGG - Intronic
957272222 3:78045893-78045915 CAAGTTTGACAGATGGAATTCGG - Intergenic
959659450 3:108849845-108849867 GAGGTTGAACAGATTGTGGTAGG - Intronic
960637839 3:119801601-119801623 GAAGTGGAACCCCTGGAGTTGGG - Intronic
961096262 3:124159169-124159191 GAATTTGAGCAGATGGAGGGAGG - Intronic
962014411 3:131425433-131425455 GAATTTGAACAAAGGCAGTTTGG + Intergenic
962426251 3:135271550-135271572 ACAGTTGAGCAGAGGGAGTTGGG + Intergenic
963039153 3:141056034-141056056 GAAGTTGAAGCAATGGACTTGGG + Intronic
963483060 3:145901741-145901763 GAAGTTAGACAGATTCAGTTTGG - Intergenic
964305836 3:155338673-155338695 GGAGTTGAAGAGATGGAAATTGG - Intergenic
965157447 3:165082364-165082386 AAAGTTGAATAACTGGAGTTTGG - Intergenic
967521245 3:190435468-190435490 GAATTTGAACACATGAAATTGGG + Intronic
970763122 4:19515786-19515808 AAAGTAAAACAGATGCAGTTTGG - Intergenic
970914063 4:21311784-21311806 CAAGATGAACAGATGCAGTGAGG + Intronic
972226833 4:37023206-37023228 AAAGTTGAACAAATTGAGGTGGG + Intergenic
972262764 4:37427150-37427172 GAAAGTATACAGATGGAGTTTGG - Intronic
973127242 4:46602456-46602478 AAAGTTGAACAGTTGGAAGTTGG - Intergenic
975438683 4:74384596-74384618 AAAGTTGAACAGATTTAGGTTGG - Intronic
976832281 4:89329040-89329062 GAAGTTGAACAGATAGATAATGG - Intergenic
978860383 4:113442093-113442115 CAAGTTGAAGAGATAGAGGTGGG - Intergenic
979350608 4:119640530-119640552 GTATTTGAACAGATGGAGAAAGG - Intergenic
980718953 4:136667633-136667655 GAAGTGGAACTGATGGATTATGG - Intergenic
981047510 4:140278868-140278890 CAAGAAGAACAGATGGGGTTGGG - Intronic
982089426 4:151867558-151867580 AATGTTGCACAGATGGAGCTGGG + Intergenic
983814943 4:172112685-172112707 GAATTTCAACAAATGGATTTTGG - Intronic
984197409 4:176675896-176675918 GAGCTTGAACATATGGATTTGGG - Intergenic
984328139 4:178279883-178279905 GAAATTGGACAGGTGGATTTGGG - Intergenic
985167668 4:187114752-187114774 GAAGGTGAACAAAAGGAGTGGGG - Intergenic
985712979 5:1440536-1440558 GAACTTCAACAGATGAACTTGGG - Intronic
986768288 5:10948189-10948211 GAAGTTGCTCAGCTGGTGTTTGG + Intergenic
987840670 5:23219132-23219154 CAAATTCAACAGATGGAGTTTGG + Intergenic
988739596 5:34057226-34057248 TAAGTAGAACAGATGGTGTGGGG + Intronic
990539686 5:56759826-56759848 GATGTTGTACAGATCGACTTGGG + Intergenic
990757553 5:59091363-59091385 GCAGTTGAACATATCCAGTTTGG - Intronic
990804462 5:59643246-59643268 TAAGTTGAGGAGATGGAGCTGGG + Intronic
991219012 5:64190601-64190623 GAACTTCAACATATGGATTTAGG - Intronic
993040355 5:82807554-82807576 GAAGTTGAACAAATGCATTAAGG + Intergenic
993415292 5:87621446-87621468 GAAGTTCAAAGGAAGGAGTTGGG - Intergenic
993866275 5:93200320-93200342 GAAGTTGAACATATGGAAAGTGG - Intergenic
994495646 5:100509072-100509094 TAAATTAAACTGATGGAGTTAGG + Intergenic
995038248 5:107559567-107559589 GAACATAAACAGATGTAGTTGGG - Intronic
996818315 5:127597657-127597679 GAAGTTGAAGAGATATAGTGTGG - Intergenic
1000774748 5:165405762-165405784 GAAGTTGACCAGGAGGAGTTTGG - Intergenic
1001140645 5:169140946-169140968 GAAGATGACAAGATGGAGATTGG - Intronic
1002821596 6:730388-730410 GAGATGGAACAGATTGAGTTTGG - Intergenic
1003054903 6:2809508-2809530 GAAGTTGAACAGAACGAAGTCGG - Intergenic
1003155196 6:3587925-3587947 GAATTTCAACATATGGATTTTGG + Intergenic
1005089210 6:22038682-22038704 AAAGTTCAAGAGATGGAGTATGG - Intergenic
1005250944 6:23945445-23945467 GGGGTTGAACACATGGAGTTAGG - Intergenic
1007279257 6:40698386-40698408 GAAGGTGTACAGATGGGCTTGGG - Intergenic
1010970789 6:82261024-82261046 GAAGTAGAACACTTGTAGTTGGG - Intergenic
1011538447 6:88403818-88403840 GAAATTAAACAGATGGAGAAGGG - Intergenic
1013773220 6:113650514-113650536 GGAGTAGAACAGACGGAGTGAGG + Intergenic
1013930772 6:115529776-115529798 TGAGGGGAACAGATGGAGTTTGG + Intergenic
1014392479 6:120879975-120879997 AATGTTGACCAGATGAAGTTGGG - Intergenic
1016662122 6:146594099-146594121 GAAGTTGCACAGACAGAGTATGG - Intergenic
1016761511 6:147742678-147742700 GAAGTTGGACAGTTGGACATTGG + Intergenic
1016986193 6:149897685-149897707 GAAGTCGGAAAGAAGGAGTTAGG + Intronic
1017809752 6:157976456-157976478 GGAGTTCAACACATGGATTTGGG + Intergenic
1019195900 6:170283058-170283080 GAAGTTGAACAGCCCGAGTCCGG + Exonic
1019327590 7:445941-445963 GAAGAGGAAAAGATGGAGGTGGG + Intergenic
1021055996 7:16046938-16046960 AAAGATGAACAGGTGGAGTAGGG + Intergenic
1026221522 7:68402104-68402126 GAAGTTGATGAAATGGAGCTTGG - Intergenic
1026387737 7:69867211-69867233 TGAGTTGATGAGATGGAGTTTGG + Intronic
1027784934 7:82568996-82569018 GCACTTCAACTGATGGAGTTTGG - Intergenic
1030282456 7:107791001-107791023 CAAGATGAACAGATTGAGGTGGG + Intronic
1030764261 7:113389589-113389611 TGAGTTGAAGAGATGGATTTGGG + Intergenic
1031706831 7:124991327-124991349 GTAGATGCTCAGATGGAGTTTGG - Intergenic
1031759087 7:125688497-125688519 GAACTTGAACATATGGATTTTGG - Intergenic
1032088180 7:128894416-128894438 GGAGTTCAACATATGGATTTGGG - Intronic
1032177777 7:129646608-129646630 GAAGAGGCACAGCTGGAGTTGGG + Intronic
1032976265 7:137226946-137226968 GAAGTTGTACAGATAGCCTTTGG + Intergenic
1033144473 7:138859593-138859615 TGAGTTGAAGAAATGGAGTTTGG - Intronic
1034485953 7:151362662-151362684 GGAGTTAAAGAGATGGAGCTGGG + Intronic
1035581310 8:741201-741223 GAAGTTAAGCAGATGGGCTTTGG + Intergenic
1035778337 8:2207772-2207794 GAAGTTGAACAGGAGCAGATGGG + Intergenic
1035778731 8:2210131-2210153 CAATTAGAAAAGATGGAGTTTGG + Intergenic
1036124094 8:6047260-6047282 GAATTTCAACAGATGAAATTTGG + Intergenic
1036255950 8:7206673-7206695 ACAGATGAACAGATGGACTTGGG + Intergenic
1036361538 8:8080826-8080848 ACAGATGAACAGATGGACTTGGG - Intergenic
1036605055 8:10297242-10297264 GAAGATGAACAAATGGAGAGGGG - Intronic
1037121267 8:15290255-15290277 GAAGTTTAGCAGATGAAGTGGGG - Intergenic
1039098406 8:33912823-33912845 GAAGGTGAGAAGATGGAGATGGG - Intergenic
1039192198 8:34988766-34988788 GAAGTTCAACATATGAATTTGGG + Intergenic
1044495871 8:92881716-92881738 GAAGTTGAAGAGCTGGAGAAGGG + Intergenic
1044557183 8:93575976-93575998 GAAGATGAATAGAAGGAGTTAGG + Intergenic
1045048716 8:98303346-98303368 GAATTTGGATAGATGGAGGTGGG + Intergenic
1045233645 8:100330127-100330149 GAAGTGGAAGGGATGGTGTTTGG - Intronic
1046036802 8:108852729-108852751 GAACTTGAACACATGCAGTCTGG - Intergenic
1046103564 8:109642243-109642265 GAAGTTGAACACATGGACACAGG + Intronic
1053696142 9:40641221-40641243 GAAGTAAAACACATGCAGTTAGG + Intergenic
1054307389 9:63440440-63440462 GAAGTAAAACACATGCAGTTAGG + Intergenic
1054406121 9:64764451-64764473 GAAGTAAAACACATGCAGTTAGG + Intergenic
1054439747 9:65249924-65249946 GAAGTAAAACACATGCAGTTAGG + Intergenic
1054490660 9:65772015-65772037 GAAGTAAAACACATGCAGTTAGG - Intergenic
1056234809 9:84584205-84584227 GAAGTAGAAGAGATGAAGGTAGG + Intergenic
1056736132 9:89210809-89210831 GAATTTCAACAGATGAATTTAGG + Intergenic
1058555327 9:106160525-106160547 GAAGAGGAACAGATGGAGCAGGG + Intergenic
1058837466 9:108871324-108871346 GGTGTTGAACTCATGGAGTTTGG + Intronic
1058998108 9:110319663-110319685 GAAGTTGAACAGAGAGAAGTTGG + Intronic
1059810239 9:117848745-117848767 GCAGTTAAACACATGGACTTTGG - Intergenic
1060484203 9:124036943-124036965 GAAGGTGATCAGATGGAGAAGGG + Intergenic
1202778590 9_KI270717v1_random:14882-14904 GAAGTAAAACACATGCAGTTAGG + Intergenic
1186207698 X:7217223-7217245 GAGGTTGAACAGATGGAGGGGGG + Intergenic
1188412020 X:29884688-29884710 GATTTTGAACATATGGAGTTTGG - Intronic
1190835093 X:54093362-54093384 GAAGTTGAACAGATTGTTCTGGG + Intronic
1192417951 X:71001217-71001239 GAAGTTGAACAGGTGTAGAATGG - Intergenic
1193691300 X:84647526-84647548 TAAGTTGCACATATGGAATTTGG + Intergenic
1194048205 X:89035276-89035298 GAACTTCAACAGATGTAGTTAGG + Intergenic
1194773908 X:97939275-97939297 GAAATTGCACAGATGGAGAGGGG - Intergenic
1195011722 X:100738685-100738707 GAAGTTCAACAGATGAATTTGGG + Intergenic
1195619497 X:106938856-106938878 GAAATTGCAAAGATGGAGATGGG + Intronic
1196190162 X:112785802-112785824 GAAGTAGAACTGATAGAATTTGG + Intronic
1197096232 X:122599169-122599191 GATGGTGAATAGTTGGAGTTAGG + Intergenic
1197318918 X:125003939-125003961 CAGGTTGAGTAGATGGAGTTAGG - Intergenic
1197348528 X:125354067-125354089 AAAGTTGAAAATATGTAGTTAGG + Intergenic
1197484143 X:127026070-127026092 GAGTTTGAACATGTGGAGTTTGG + Intergenic
1198235388 X:134732106-134732128 GGAGTTGTGCAGATGGAGGTGGG + Intronic
1199513825 X:148653719-148653741 GAAGTTGAAATTATGGAATTGGG + Intronic
1201193896 Y:11473159-11473181 GAAGTAAAACATATGCAGTTAGG + Intergenic